Mutagenetix > Incidental Mutation

Incidental Mutation 'R7334:Tinag'

569378

Institutional Source

Beutler Lab

Gene Symbol

Tinag

Ensembl Gene

ENSMUSG00000032357

Gene Name

tubulointerstitial nephritis antigen

Synonyms

TIN-ag

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.112) question?

Stock #

R7334 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

76951693-77045794 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 77001649 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Serine at position 337 (C337S)

Ref Sequence

ENSEMBL: ENSMUSP00000034911 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034911] [ENSMUST00000184897]

AlphaFold

Q9WUR0

Predicted Effect

probably damaging
Transcript: ENSMUST00000034911
AA Change: C337S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000034911
Gene: ENSMUSG00000032357
AA Change: C337S

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
SO	58	105	1.68e-11	SMART
Pept_C1	216	466	1.83e-52	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000184897

SMART Domains

Protein: ENSMUSP00000139155
Gene: ENSMUSG00000032357

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
SO	58	105	1.68e-11	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

99% (75/76)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycoprotein that is restricted within the kidney to the basement membranes underlying the epithelium of Bowman's capsule and proximal and distal tubules. Autoantibodies against this protein are found in sera of patients with tubulointerstital nephritis, membranous nephropathy and anti-glomerular basement membrane nephritis. Ontogeny studies suggest that the expression of this antigen is developmentally regulated in a precise spatial and temporal pattern throughout nephrogenesis. [provided by RefSeq, Nov 2011]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acadm	G	T	3: 153,939,061	S9*	probably null	Het
Acot10	C	T	15: 20,665,543	V371I	possibly damaging	Het
Adam8	T	C	7: 139,988,990	E199G	probably damaging	Het
Aldh18a1	A	T	19: 40,551,252	W762R	probably damaging	Het
Aldh1a1	T	A	19: 20,621,711	V162E	probably damaging	Het
Alms1	A	G	6: 85,641,450	D2357G	probably damaging	Het
Arfgef1	G	T	1: 10,184,460	Q718K	probably damaging	Het
Arid5b	A	C	10: 68,243,177	V110G	possibly damaging	Het
Bpifb3	T	A	2: 153,919,734	D34E	probably damaging	Het
Cacfd1	C	T	2: 27,015,546	A85V	possibly damaging	Het
Cep57l1	C	A	10: 41,721,600	S345I	probably benign	Het
Clca3b	G	A	3: 144,836,656	R462*	probably null	Het
Cyp26c1	G	A	19: 37,688,875	V251I	probably benign	Het
Dip2a	A	G	10: 76,274,246	S1179P	possibly damaging	Het
Dnal1	T	C	12: 84,127,006	L27P	probably damaging	Het
Dock7	A	G	4: 98,975,943	V1288A	unknown	Het
Elmod1	A	T	9: 53,934,224		probably null	Het
Epb41l5	T	G	1: 119,623,949	K102T	probably damaging	Het
Fam92b	T	C	8: 120,174,850	T39A	probably damaging	Het
Fermt3	T	C	19: 7,003,038	I358V	probably benign	Het
Frmd3	A	G	4: 74,161,718	I316V	probably benign	Het
Fryl	T	C	5: 73,047,496		probably null	Het
Gm12394	G	A	4: 42,793,856	T92I	possibly damaging	Het
Gm4131	T	A	14: 62,464,907	H204L	possibly damaging	Het
Gm8298	T	A	3: 59,868,959	C184S	probably damaging	Het
Hmcn2	G	A	2: 31,435,794	G4278R	probably damaging	Het
Hmcn2	A	G	2: 31,453,135	S4558G	possibly damaging	Het
Igkv1-132	A	G	6: 67,760,124	T25A	probably benign	Het
Kcp	T	C	6: 29,485,512	E1161G	probably damaging	Het
Macf1	A	T	4: 123,399,442	I5371K	probably damaging	Het
Malrd1	T	A	2: 16,006,718	C1670S	probably damaging	Het
Mfsd13a	T	A	19: 46,368,370	V270E	probably damaging	Het
Mroh1	A	G	15: 76,427,638	I524V	probably benign	Het
Mta1	T	C	12: 113,126,798	S175P	possibly damaging	Het
Myo7a	C	T	7: 98,079,366	R800H	probably benign	Het
Ncald	T	A	15: 37,397,280	Y52F	probably damaging	Het
Nomo1	T	C	7: 46,083,268	S1152P	probably damaging	Het
Nr3c1	A	G	18: 39,487,037	F66L	probably benign	Het
Nrf1	T	C	6: 30,118,971	L363S	probably benign	Het
Olfr732	C	A	14: 50,281,579	V225F	probably benign	Het
Olfr875	A	T	9: 37,772,997	I113F	probably damaging	Het
Osbpl3	A	G	6: 50,344,906	M300T	possibly damaging	Het
Parpbp	T	A	10: 88,111,755	N339I	probably damaging	Het
Pdlim5	A	T	3: 142,244,917	H578Q	probably damaging	Het
Pear1	T	C	3: 87,750,225	N1009S	probably damaging	Het
Pnpla8	A	G	12: 44,311,503	I745M	probably damaging	Het
Pom121l12	C	A	11: 14,599,681	T129K	probably damaging	Het
Ppp1r14a	T	C	7: 29,293,262	S130P	probably damaging	Het
Prss12	A	C	3: 123,487,131	L488F	probably benign	Het
Psd3	C	T	8: 67,908,705	V559I	possibly damaging	Het
Rrh	T	C	3: 129,808,982	T364A	probably benign	Het
Shcbp1	A	T	8: 4,741,876	M479K	probably damaging	Het
Shcbp1	A	C	8: 4,754,310	F200C	probably damaging	Het
Slc9a3r1	C	T	11: 115,163,767	A81V	possibly damaging	Het
Slx1b	G	T	7: 126,692,527	R122S	probably damaging	Het
Spidr	A	G	16: 16,114,825		probably null	Het
St18	G	A	1: 6,802,559	D173N	probably benign	Het
Stambpl1	T	C	19: 34,226,648	I46T	probably damaging	Het
Syne1	C	T	10: 5,057,886	D113N	probably damaging	Het
Tg	G	A	15: 66,725,272	V1741I	probably benign	Het
Thsd7b	T	A	1: 130,195,275	W1544R	probably benign	Het
Tiam2	G	A	17: 3,503,008	R1120H	possibly damaging	Het
Tm4sf1	G	C	3: 57,293,089	A64G	probably damaging	Het
Tmprss6	A	G	15: 78,443,817	Y572H	unknown	Het
Tnfrsf11a	G	A	1: 105,827,129	A309T	possibly damaging	Het
Txndc11	A	G	16: 11,128,561	Y129H	probably damaging	Het
Ube3b	T	C	5: 114,415,681	F974S	possibly damaging	Het
Utrn	C	A	10: 12,728,009		probably null	Het
Vmn1r58	T	A	7: 5,411,067	M55L	probably benign	Het
Vnn1	T	A	10: 23,900,760	S336R	probably benign	Het
Wwc2	T	C	8: 47,869,794	Y424C	unknown	Het
Zfp507	T	C	7: 35,776,080	I903V	probably damaging	Het
Zfp551	C	T	7: 12,416,754	G243R	probably damaging	Het
Zfp60	T	A	7: 27,749,019	C371S	probably damaging	Het

Other mutations in Tinag

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01450:Tinag	APN	9	77045576	missense	possibly damaging	0.93
IGL01524:Tinag	APN	9	77045538	missense	probably damaging	1.00
IGL01537:Tinag	APN	9	77045603	missense	probably benign	0.01
IGL01832:Tinag	APN	9	77031756	missense	probably benign	0.18
IGL02512:Tinag	APN	9	77031787	splice site	probably benign
IGL02888:Tinag	APN	9	77031713	missense	probably benign	0.24
G1citation:Tinag	UTSW	9	77031702	missense	probably benign	0.00
R0179:Tinag	UTSW	9	76996882	splice site	probably benign
R0200:Tinag	UTSW	9	76951935	missense	probably damaging	1.00
R0206:Tinag	UTSW	9	76999852	missense	probably damaging	1.00
R0545:Tinag	UTSW	9	77031710	missense	possibly damaging	0.61
R0666:Tinag	UTSW	9	77005687	missense	probably benign	0.02
R0685:Tinag	UTSW	9	76952003	missense	probably damaging	1.00
R0732:Tinag	UTSW	9	77001654	missense	possibly damaging	0.93
R1445:Tinag	UTSW	9	77045516	missense	probably damaging	1.00
R2318:Tinag	UTSW	9	77045411	missense	probably damaging	1.00
R3809:Tinag	UTSW	9	76951905	missense	probably benign	0.15
R4747:Tinag	UTSW	9	76996956	missense	probably benign
R4781:Tinag	UTSW	9	76996950	missense	possibly damaging	0.69
R5110:Tinag	UTSW	9	76952007	missense	probably damaging	1.00
R5328:Tinag	UTSW	9	77005631	nonsense	probably null
R5605:Tinag	UTSW	9	77045412	missense	probably damaging	1.00
R5897:Tinag	UTSW	9	77045444	missense	probably damaging	1.00
R6296:Tinag	UTSW	9	76996935	missense	possibly damaging	0.67
R6822:Tinag	UTSW	9	77031702	missense	probably benign	0.00
R6915:Tinag	UTSW	9	77001615	missense	probably damaging	1.00
R7285:Tinag	UTSW	9	77045661	missense	probably benign
R7974:Tinag	UTSW	9	76999849	missense	probably benign	0.01
R8354:Tinag	UTSW	9	77031695	missense	probably damaging	1.00
R8454:Tinag	UTSW	9	77031695	missense	probably damaging	1.00
R9029:Tinag	UTSW	9	77027014	splice site	probably benign
R9072:Tinag	UTSW	9	76997018	critical splice acceptor site	probably null
R9073:Tinag	UTSW	9	76997018	critical splice acceptor site	probably null
R9508:Tinag	UTSW	9	77005699	missense	probably damaging	1.00
Z1177:Tinag	UTSW	9	77045498	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GAGAAGTCTACATGTAAGCACAAC -3'
(R):5'- GACATTTTCGAACTATGCAGGTG -3'

Sequencing Primer
(F):5'- GTCTACATGTAAGCACAACATTTGG -3'
(R):5'- TCGAACTATGCAGGTGAATAAATAGC -3'

Posted On

2019-09-13