Mutagenetix > Incidental Mutations

Incidental Mutation 'R7334:Vnn1'

569380

Institutional Source

Beutler Lab

Gene Symbol

Vnn1

Ensembl Gene

ENSMUSG00000037440

Gene Name

vanin 1

Synonyms

V-1, pantetheinase

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.084) question?

Stock #

R7334 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

23894688-23905343 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 23900760 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Arginine at position 336 (S336R)

Ref Sequence

ENSEMBL: ENSMUSP00000040599 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041416]

Predicted Effect

probably benign
Transcript: ENSMUST00000041416
AA Change: S336R

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000040599
Gene: ENSMUSG00000037440
AA Change: S336R

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
Pfam:CN_hydrolase	52	279	2.5e-19	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

99% (75/76)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the vanin family of proteins, which share extensive sequence similarity with each other, and also with biotinidase. The family includes secreted and membrane-associated proteins, a few of which have been reported to participate in hematopoietic cell trafficking. No biotinidase activity has been demonstrated for any of the vanin proteins, however, they possess pantetheinase activity, which may play a role in oxidative-stress response. This protein, like its mouse homolog, is likely a GPI-anchored cell surface molecule. The mouse protein is expressed by the perivascular thymic stromal cells and regulates migration of T-cell progenitors to the thymus. This gene lies in close proximity to, and in the same transcriptional orientation as, two other vanin genes on chromosome 6q23-q24. [provided by RefSeq, Feb 2009]
PHENOTYPE: Mice homozygous for disruptions of this gene develop normally and so no abnormalities in the maturation of lymphoid organs. However, membrane bound pantetheinase is absent in livers and kidneys resuulting in an absence of cysteamine in these organs. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acadm	G	T	3: 153,939,061	S9*	probably null	Het
Acot10	C	T	15: 20,665,543	V371I	possibly damaging	Het
Adam8	T	C	7: 139,988,990	E199G	probably damaging	Het
Aldh18a1	A	T	19: 40,551,252	W762R	probably damaging	Het
Aldh1a1	T	A	19: 20,621,711	V162E	probably damaging	Het
Alms1	A	G	6: 85,641,450	D2357G	probably damaging	Het
Arfgef1	G	T	1: 10,184,460	Q718K	probably damaging	Het
Arid5b	A	C	10: 68,243,177	V110G	possibly damaging	Het
Bpifb3	T	A	2: 153,919,734	D34E	probably damaging	Het
Cacfd1	C	T	2: 27,015,546	A85V	possibly damaging	Het
Cep57l1	C	A	10: 41,721,600	S345I	probably benign	Het
Clca3b	G	A	3: 144,836,656	R462*	probably null	Het
Cyp26c1	G	A	19: 37,688,875	V251I	probably benign	Het
Dip2a	A	G	10: 76,274,246	S1179P	possibly damaging	Het
Dnal1	T	C	12: 84,127,006	L27P	probably damaging	Het
Dock7	A	G	4: 98,975,943	V1288A	unknown	Het
Elmod1	A	T	9: 53,934,224		probably null	Het
Epb41l5	T	G	1: 119,623,949	K102T	probably damaging	Het
Fam92b	T	C	8: 120,174,850	T39A	probably damaging	Het
Fermt3	T	C	19: 7,003,038	I358V	probably benign	Het
Frmd3	A	G	4: 74,161,718	I316V	probably benign	Het
Fryl	T	C	5: 73,047,496		probably null	Het
Gm12394	G	A	4: 42,793,856	T92I	possibly damaging	Het
Gm4131	T	A	14: 62,464,907	H204L	possibly damaging	Het
Gm8298	T	A	3: 59,868,959	C184S	probably damaging	Het
Hmcn2	G	A	2: 31,435,794	G4278R	probably damaging	Het
Hmcn2	A	G	2: 31,453,135	S4558G	possibly damaging	Het
Igkv1-132	A	G	6: 67,760,124	T25A	probably benign	Het
Kcp	T	C	6: 29,485,512	E1161G	probably damaging	Het
Macf1	A	T	4: 123,399,442	I5371K	probably damaging	Het
Malrd1	T	A	2: 16,006,718	C1670S	probably damaging	Het
Mfsd13a	T	A	19: 46,368,370	V270E	probably damaging	Het
Mroh1	A	G	15: 76,427,638	I524V	probably benign	Het
Mta1	T	C	12: 113,126,798	S175P	possibly damaging	Het
Myo7a	C	T	7: 98,079,366	R800H	probably benign	Het
Ncald	T	A	15: 37,397,280	Y52F	probably damaging	Het
Nomo1	T	C	7: 46,083,268	S1152P	probably damaging	Het
Nr3c1	A	G	18: 39,487,037	F66L	probably benign	Het
Nrf1	T	C	6: 30,118,971	L363S	probably benign	Het
Olfr732	C	A	14: 50,281,579	V225F	probably benign	Het
Olfr875	A	T	9: 37,772,997	I113F	probably damaging	Het
Osbpl3	A	G	6: 50,344,906	M300T	possibly damaging	Het
Parpbp	T	A	10: 88,111,755	N339I	probably damaging	Het
Pdlim5	A	T	3: 142,244,917	H578Q	probably damaging	Het
Pear1	T	C	3: 87,750,225	N1009S	probably damaging	Het
Pnpla8	A	G	12: 44,311,503	I745M	probably damaging	Het
Pom121l12	C	A	11: 14,599,681	T129K	probably damaging	Het
Ppp1r14a	T	C	7: 29,293,262	S130P	probably damaging	Het
Prss12	A	C	3: 123,487,131	L488F	probably benign	Het
Psd3	C	T	8: 67,908,705	V559I	possibly damaging	Het
Rrh	T	C	3: 129,808,982	T364A	probably benign	Het
Shcbp1	A	T	8: 4,741,876	M479K	probably damaging	Het
Shcbp1	A	C	8: 4,754,310	F200C	probably damaging	Het
Slc9a3r1	C	T	11: 115,163,767	A81V	possibly damaging	Het
Slx1b	G	T	7: 126,692,527	R122S	probably damaging	Het
Spidr	A	G	16: 16,114,825		probably null	Het
St18	G	A	1: 6,802,559	D173N	probably benign	Het
Stambpl1	T	C	19: 34,226,648	I46T	probably damaging	Het
Syne1	C	T	10: 5,057,886	D113N	probably damaging	Het
Tg	G	A	15: 66,725,272	V1741I	probably benign	Het
Thsd7b	T	A	1: 130,195,275	W1544R	probably benign	Het
Tiam2	G	A	17: 3,503,008	R1120H	possibly damaging	Het
Tinag	A	T	9: 77,001,649	C337S	probably damaging	Het
Tm4sf1	G	C	3: 57,293,089	A64G	probably damaging	Het
Tmprss6	A	G	15: 78,443,817	Y572H	unknown	Het
Tnfrsf11a	G	A	1: 105,827,129	A309T	possibly damaging	Het
Txndc11	A	G	16: 11,128,561	Y129H	probably damaging	Het
Ube3b	T	C	5: 114,415,681	F974S	possibly damaging	Het
Utrn	C	A	10: 12,728,009		probably null	Het
Vmn1r58	T	A	7: 5,411,067	M55L	probably benign	Het
Wwc2	T	C	8: 47,869,794	Y424C	unknown	Het
Zfp507	T	C	7: 35,776,080	I903V	probably damaging	Het
Zfp551	C	T	7: 12,416,754	G243R	probably damaging	Het
Zfp60	T	A	7: 27,749,019	C371S	probably damaging	Het

Other mutations in Vnn1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00838:Vnn1	APN	10	23900779	missense	possibly damaging	0.51
IGL01299:Vnn1	APN	10	23895051	missense	probably damaging	1.00
IGL01353:Vnn1	APN	10	23900840	missense	probably damaging	1.00
IGL01774:Vnn1	APN	10	23900710	missense	probably benign	0.26
IGL01970:Vnn1	APN	10	23897402	missense	probably benign	0.06
IGL01985:Vnn1	APN	10	23900744	missense	probably benign	0.00
IGL02019:Vnn1	APN	10	23903551	missense	possibly damaging	0.69
IGL02198:Vnn1	APN	10	23903425	missense	probably benign	0.00
IGL02349:Vnn1	APN	10	23898503	missense	possibly damaging	0.91
IGL02738:Vnn1	APN	10	23904622	missense	probably benign	0.00
IGL03058:Vnn1	APN	10	23904544	missense	probably benign	0.06
R0008:Vnn1	UTSW	10	23898602	critical splice donor site	probably null
R0030:Vnn1	UTSW	10	23900846	missense	probably benign	0.08
R0508:Vnn1	UTSW	10	23895012	missense	probably benign	0.01
R0781:Vnn1	UTSW	10	23899601	missense	possibly damaging	0.46
R1110:Vnn1	UTSW	10	23899601	missense	possibly damaging	0.46
R1757:Vnn1	UTSW	10	23900828	missense	possibly damaging	0.49
R1757:Vnn1	UTSW	10	23900829	missense	probably benign	0.00
R1778:Vnn1	UTSW	10	23899517	missense	possibly damaging	0.67
R2011:Vnn1	UTSW	10	23894971	nonsense	probably null
R2055:Vnn1	UTSW	10	23900577	splice site	probably benign
R2158:Vnn1	UTSW	10	23900755	nonsense	probably null
R2186:Vnn1	UTSW	10	23897401	missense	probably benign	0.29
R4277:Vnn1	UTSW	10	23898512	missense	possibly damaging	0.89
R4279:Vnn1	UTSW	10	23898512	missense	possibly damaging	0.89
R4473:Vnn1	UTSW	10	23894891	missense	probably benign
R4590:Vnn1	UTSW	10	23899405	missense	possibly damaging	0.61
R4708:Vnn1	UTSW	10	23897352	missense	probably benign	0.01
R4794:Vnn1	UTSW	10	23900704	missense	probably benign	0.01
R5266:Vnn1	UTSW	10	23903405	missense	probably damaging	1.00
R5495:Vnn1	UTSW	10	23898564	missense	probably damaging	0.98
R6064:Vnn1	UTSW	10	23894909	missense	probably benign	0.05
R7081:Vnn1	UTSW	10	23895005	missense	possibly damaging	0.66
R7088:Vnn1	UTSW	10	23900747	missense	probably benign	0.00
R7221:Vnn1	UTSW	10	23895054	missense	probably benign	0.07

Predicted Primers

PCR Primer
(F):5'- GGAAGTGGTATCTATGCACCC -3'
(R):5'- CAGTTTTGCTCGTCATTGGATC -3'

Sequencing Primer
(F):5'- GAAGTGGTATCTATGCACCCGATTC -3'
(R):5'- GATCTTCTGGGGCTGACATTACC -3'

Posted On

2019-09-13