Mutagenetix > Incidental Mutation

Incidental Mutation 'R7334:Arid5b'

569382

Institutional Source

Beutler Lab

Gene Symbol

Arid5b

Ensembl Gene

ENSMUSG00000019947

Gene Name

AT rich interactive domain 5B (MRF1-like)

Synonyms

5430435G07Rik, Mrf2beta, Mrf2alpha, Mrf2, Desrt

MMRRC Submission

Accession Numbers

Genbank: NM_023598; MGI: 2175912

Essential gene?

Probably essential (E-score: 0.900) question?

Stock #

R7334 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

68092520-68278740 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 68243177 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glycine at position 110 (V110G)

Ref Sequence

ENSEMBL: ENSMUSP00000151227 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020106] [ENSMUST00000219238]

AlphaFold

Q8BM75

Predicted Effect

possibly damaging
Transcript: ENSMUST00000020106
AA Change: V110G

PolyPhen 2 Score 0.489 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000020106
Gene: ENSMUSG00000019947
AA Change: V110G

Domain	Start	End	E-Value	Type
ARID	316	407	8.29e-35	SMART
BRIGHT	320	412	4.18e-38	SMART
low complexity region	425	438	N/A	INTRINSIC
low complexity region	451	462	N/A	INTRINSIC
low complexity region	538	549	N/A	INTRINSIC
low complexity region	695	718	N/A	INTRINSIC
low complexity region	730	741	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000219238
AA Change: V110G

PolyPhen 2 Score 0.612 (Sensitivity: 0.87; Specificity: 0.91)

Meta Mutation Damage Score

0.2737

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

99% (75/76)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the AT-rich interaction domain (ARID) family of DNA binding proteins. The encoded protein forms a histone H3K9Me2 demethylase complex with PHD finger protein 2 and regulates the transcription of target genes involved in adipogenesis and liver development. This gene also plays a role in cell growth and differentiation of B-lymphocyte progenitors, and single nucleotide polymorphisms in this gene are associated with acute lymphoblastic leukemia. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene experience a high level of mortality perinatally or earlier. Growth rates are low and mice remain small throughout live. There are abnormalities in various organ systems as well as the reproductive system. Fertility is reduced. [provided by MGI curators]

Allele List at MGI

All alleles(212) : Targeted, knock-out(2) Gene trapped(210)

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acadm	G	T	3: 153,939,061	S9*	probably null	Het
Acot10	C	T	15: 20,665,543	V371I	possibly damaging	Het
Adam8	T	C	7: 139,988,990	E199G	probably damaging	Het
Aldh18a1	A	T	19: 40,551,252	W762R	probably damaging	Het
Aldh1a1	T	A	19: 20,621,711	V162E	probably damaging	Het
Alms1	A	G	6: 85,641,450	D2357G	probably damaging	Het
Arfgef1	G	T	1: 10,184,460	Q718K	probably damaging	Het
Bpifb3	T	A	2: 153,919,734	D34E	probably damaging	Het
Cacfd1	C	T	2: 27,015,546	A85V	possibly damaging	Het
Cep57l1	C	A	10: 41,721,600	S345I	probably benign	Het
Clca3b	G	A	3: 144,836,656	R462*	probably null	Het
Cyp26c1	G	A	19: 37,688,875	V251I	probably benign	Het
Dip2a	A	G	10: 76,274,246	S1179P	possibly damaging	Het
Dnal1	T	C	12: 84,127,006	L27P	probably damaging	Het
Dock7	A	G	4: 98,975,943	V1288A	unknown	Het
Elmod1	A	T	9: 53,934,224		probably null	Het
Epb41l5	T	G	1: 119,623,949	K102T	probably damaging	Het
Fam92b	T	C	8: 120,174,850	T39A	probably damaging	Het
Fermt3	T	C	19: 7,003,038	I358V	probably benign	Het
Frmd3	A	G	4: 74,161,718	I316V	probably benign	Het
Fryl	T	C	5: 73,047,496		probably null	Het
Gm12394	G	A	4: 42,793,856	T92I	possibly damaging	Het
Gm4131	T	A	14: 62,464,907	H204L	possibly damaging	Het
Gm8298	T	A	3: 59,868,959	C184S	probably damaging	Het
Hmcn2	G	A	2: 31,435,794	G4278R	probably damaging	Het
Hmcn2	A	G	2: 31,453,135	S4558G	possibly damaging	Het
Igkv1-132	A	G	6: 67,760,124	T25A	probably benign	Het
Kcp	T	C	6: 29,485,512	E1161G	probably damaging	Het
Macf1	A	T	4: 123,399,442	I5371K	probably damaging	Het
Malrd1	T	A	2: 16,006,718	C1670S	probably damaging	Het
Mfsd13a	T	A	19: 46,368,370	V270E	probably damaging	Het
Mroh1	A	G	15: 76,427,638	I524V	probably benign	Het
Mta1	T	C	12: 113,126,798	S175P	possibly damaging	Het
Myo7a	C	T	7: 98,079,366	R800H	probably benign	Het
Ncald	T	A	15: 37,397,280	Y52F	probably damaging	Het
Nomo1	T	C	7: 46,083,268	S1152P	probably damaging	Het
Nr3c1	A	G	18: 39,487,037	F66L	probably benign	Het
Nrf1	T	C	6: 30,118,971	L363S	probably benign	Het
Olfr732	C	A	14: 50,281,579	V225F	probably benign	Het
Olfr875	A	T	9: 37,772,997	I113F	probably damaging	Het
Osbpl3	A	G	6: 50,344,906	M300T	possibly damaging	Het
Parpbp	T	A	10: 88,111,755	N339I	probably damaging	Het
Pdlim5	A	T	3: 142,244,917	H578Q	probably damaging	Het
Pear1	T	C	3: 87,750,225	N1009S	probably damaging	Het
Pnpla8	A	G	12: 44,311,503	I745M	probably damaging	Het
Pom121l12	C	A	11: 14,599,681	T129K	probably damaging	Het
Ppp1r14a	T	C	7: 29,293,262	S130P	probably damaging	Het
Prss12	A	C	3: 123,487,131	L488F	probably benign	Het
Psd3	C	T	8: 67,908,705	V559I	possibly damaging	Het
Rrh	T	C	3: 129,808,982	T364A	probably benign	Het
Shcbp1	A	T	8: 4,741,876	M479K	probably damaging	Het
Shcbp1	A	C	8: 4,754,310	F200C	probably damaging	Het
Slc9a3r1	C	T	11: 115,163,767	A81V	possibly damaging	Het
Slx1b	G	T	7: 126,692,527	R122S	probably damaging	Het
Spidr	A	G	16: 16,114,825		probably null	Het
St18	G	A	1: 6,802,559	D173N	probably benign	Het
Stambpl1	T	C	19: 34,226,648	I46T	probably damaging	Het
Syne1	C	T	10: 5,057,886	D113N	probably damaging	Het
Tg	G	A	15: 66,725,272	V1741I	probably benign	Het
Thsd7b	T	A	1: 130,195,275	W1544R	probably benign	Het
Tiam2	G	A	17: 3,503,008	R1120H	possibly damaging	Het
Tinag	A	T	9: 77,001,649	C337S	probably damaging	Het
Tm4sf1	G	C	3: 57,293,089	A64G	probably damaging	Het
Tmprss6	A	G	15: 78,443,817	Y572H	unknown	Het
Tnfrsf11a	G	A	1: 105,827,129	A309T	possibly damaging	Het
Txndc11	A	G	16: 11,128,561	Y129H	probably damaging	Het
Ube3b	T	C	5: 114,415,681	F974S	possibly damaging	Het
Utrn	C	A	10: 12,728,009		probably null	Het
Vmn1r58	T	A	7: 5,411,067	M55L	probably benign	Het
Vnn1	T	A	10: 23,900,760	S336R	probably benign	Het
Wwc2	T	C	8: 47,869,794	Y424C	unknown	Het
Zfp507	T	C	7: 35,776,080	I903V	probably damaging	Het
Zfp551	C	T	7: 12,416,754	G243R	probably damaging	Het
Zfp60	T	A	7: 27,749,019	C371S	probably damaging	Het

Other mutations in Arid5b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00229:Arid5b	APN	10	68128975	missense	probably damaging	0.96
IGL01731:Arid5b	APN	10	68097609	missense	probably damaging	1.00
IGL02069:Arid5b	APN	10	68097399	missense	probably damaging	1.00
IGL02161:Arid5b	APN	10	68096668	missense	probably benign	0.00
IGL02555:Arid5b	APN	10	68101904	missense	probably benign	0.01
IGL02873:Arid5b	APN	10	68101950	missense	probably benign	0.06
IGL03119:Arid5b	APN	10	68243227	missense	probably damaging	1.00
IGL03271:Arid5b	APN	10	68097457	missense	possibly damaging	0.73
gobi	UTSW	10	68118345	missense	possibly damaging	0.92
3-1:Arid5b	UTSW	10	68098589	missense	probably damaging	1.00
PIT4677001:Arid5b	UTSW	10	68098011	missense	probably damaging	0.99
R0108:Arid5b	UTSW	10	68278729	utr 5 prime	probably benign
R0525:Arid5b	UTSW	10	68097846	missense	possibly damaging	0.90
R0533:Arid5b	UTSW	10	68186033	missense	probably damaging	1.00
R0646:Arid5b	UTSW	10	68096977	missense	probably damaging	1.00
R1066:Arid5b	UTSW	10	68098356	missense	probably benign	0.04
R1487:Arid5b	UTSW	10	68097214	nonsense	probably null
R1638:Arid5b	UTSW	10	68277947	missense	possibly damaging	0.48
R1789:Arid5b	UTSW	10	68186067	missense	probably damaging	0.99
R2031:Arid5b	UTSW	10	68278688	critical splice donor site	probably null
R2337:Arid5b	UTSW	10	68097777	missense	possibly damaging	0.63
R2996:Arid5b	UTSW	10	68098462	missense	probably benign	0.01
R2997:Arid5b	UTSW	10	68098462	missense	probably benign	0.01
R3547:Arid5b	UTSW	10	68098462	missense	probably benign	0.01
R4411:Arid5b	UTSW	10	68096689	missense	probably damaging	1.00
R4860:Arid5b	UTSW	10	68243095	missense	probably damaging	0.97
R4860:Arid5b	UTSW	10	68243095	missense	probably damaging	0.97
R5219:Arid5b	UTSW	10	68278110	missense	probably benign	0.08
R5341:Arid5b	UTSW	10	68278127	missense	possibly damaging	0.87
R5434:Arid5b	UTSW	10	68096889	missense	possibly damaging	0.67
R5757:Arid5b	UTSW	10	68102079	missense	probably damaging	1.00
R6114:Arid5b	UTSW	10	68097744	missense	possibly damaging	0.89
R6313:Arid5b	UTSW	10	68097582	missense	possibly damaging	0.95
R6338:Arid5b	UTSW	10	68098561	nonsense	probably null
R6525:Arid5b	UTSW	10	68097666	missense	possibly damaging	0.47
R6915:Arid5b	UTSW	10	68186212	nonsense	probably null
R7013:Arid5b	UTSW	10	68097819	missense	probably damaging	1.00
R7099:Arid5b	UTSW	10	68098179	missense	probably damaging	1.00
R7260:Arid5b	UTSW	10	68097807	missense	probably damaging	1.00
R7324:Arid5b	UTSW	10	68128922	missense	probably benign	0.44
R7432:Arid5b	UTSW	10	68118266	missense	probably damaging	1.00
R7453:Arid5b	UTSW	10	68243164	missense	probably benign	0.01
R7649:Arid5b	UTSW	10	68118345	missense	possibly damaging	0.92
R7659:Arid5b	UTSW	10	68098587	missense	probably benign
R7661:Arid5b	UTSW	10	68098587	missense	probably benign
R7662:Arid5b	UTSW	10	68098587	missense	probably benign
R7663:Arid5b	UTSW	10	68098587	missense	probably benign
R7665:Arid5b	UTSW	10	68098587	missense	probably benign
R7666:Arid5b	UTSW	10	68098587	missense	probably benign
R7759:Arid5b	UTSW	10	68097802	missense	probably damaging	1.00
R7779:Arid5b	UTSW	10	68096776	missense	probably damaging	1.00
R7788:Arid5b	UTSW	10	68098587	missense	probably benign
R7789:Arid5b	UTSW	10	68098587	missense	probably benign
R7875:Arid5b	UTSW	10	68128941	missense	probably benign	0.02
R8079:Arid5b	UTSW	10	68098356	missense	possibly damaging	0.88
R8096:Arid5b	UTSW	10	68186152	missense	probably benign	0.00
R8228:Arid5b	UTSW	10	68278706	missense	possibly damaging	0.95
R8377:Arid5b	UTSW	10	68097387	missense	probably damaging	0.96
R8757:Arid5b	UTSW	10	68097810	missense	probably damaging	1.00
R8910:Arid5b	UTSW	10	68098278	missense
R8954:Arid5b	UTSW	10	68101980	missense	possibly damaging	0.88
R9234:Arid5b	UTSW	10	68128798	missense	possibly damaging	0.82
R9272:Arid5b	UTSW	10	68102052	missense	probably damaging	0.99
R9430:Arid5b	UTSW	10	68186257	critical splice acceptor site	probably null
X0066:Arid5b	UTSW	10	68118302	missense	probably damaging	1.00
Z1177:Arid5b	UTSW	10	68097228	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- ATGTAGCTCACTGCACATCCC -3'
(R):5'- CATTTGCTGGAAGGTGAGGC -3'

Sequencing Primer
(F):5'- AGCCGTGCTTACCGAGATCAG -3'
(R):5'- CTCCTGTAGGATGAGGTCAT -3'

Posted On

2019-09-13