Incidental Mutation 'R7334:Mta1'
ID 569389
Institutional Source Beutler Lab
Gene Symbol Mta1
Ensembl Gene ENSMUSG00000021144
Gene Name metastasis associated 1
Synonyms
MMRRC Submission 045371-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7334 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 113061898-113100826 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 113090418 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 175 (S175P)
Ref Sequence ENSEMBL: ENSMUSP00000105348 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009099] [ENSMUST00000069690] [ENSMUST00000109723] [ENSMUST00000109726] [ENSMUST00000109727]
AlphaFold Q8K4B0
Predicted Effect probably benign
Transcript: ENSMUST00000009099
AA Change: S192P

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000009099
Gene: ENSMUSG00000021144
AA Change: S192P

DomainStartEndE-ValueType
BAH 4 164 1.85e-30 SMART
ELM2 167 221 2.36e-13 SMART
SANT 284 333 2.62e-8 SMART
ZnF_GATA 387 441 2.6e-16 SMART
low complexity region 545 565 N/A INTRINSIC
low complexity region 695 705 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000069690
AA Change: S175P

PolyPhen 2 Score 0.593 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000064338
Gene: ENSMUSG00000021144
AA Change: S175P

DomainStartEndE-ValueType
BAH 4 147 2.7e-32 SMART
ELM2 150 204 2.36e-13 SMART
SANT 267 316 2.62e-8 SMART
ZnF_GATA 370 424 2.6e-16 SMART
low complexity region 528 548 N/A INTRINSIC
low complexity region 678 688 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109723
AA Change: S192P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000105345
Gene: ENSMUSG00000021144
AA Change: S192P

DomainStartEndE-ValueType
BAH 4 164 1.85e-30 SMART
ELM2 167 221 2.36e-13 SMART
SANT 284 333 2.62e-8 SMART
ZnF_GATA 387 441 2.6e-16 SMART
low complexity region 545 565 N/A INTRINSIC
low complexity region 683 693 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000109726
AA Change: S175P

PolyPhen 2 Score 0.593 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000105348
Gene: ENSMUSG00000021144
AA Change: S175P

DomainStartEndE-ValueType
BAH 4 147 2.7e-32 SMART
ELM2 150 204 2.36e-13 SMART
SANT 267 316 2.62e-8 SMART
ZnF_GATA 370 424 2.6e-16 SMART
low complexity region 528 548 N/A INTRINSIC
low complexity region 678 688 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109727
AA Change: S192P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000105349
Gene: ENSMUSG00000021144
AA Change: S192P

DomainStartEndE-ValueType
BAH 4 164 1.85e-30 SMART
ELM2 167 221 2.36e-13 SMART
SANT 284 333 2.62e-8 SMART
ZnF_GATA 387 441 2.6e-16 SMART
low complexity region 545 565 N/A INTRINSIC
low complexity region 683 693 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130926
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134488
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156030
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (75/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that was identified in a screen for genes expressed in metastatic cells, specifically, mammary adenocarcinoma cell lines. Expression of this gene has been correlated with the metastatic potential of at least two types of carcinomas although it is also expressed in many normal tissues. The role it plays in metastasis is unclear. It was initially thought to be the 70kD component of a nucleosome remodeling deacetylase complex, NuRD, but it is more likely that this component is a different but very similar protein. These two proteins are so closely related, though, that they share the same types of domains. These domains include two DNA binding domains, a dimerization domain, and a domain commonly found in proteins that methylate DNA. The profile and activity of this gene product suggest that it is involved in regulating transcription and that this may be accomplished by chromatin remodeling. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased cellular sensitivity to ionizing radiation and increased retinal cell proliferation at E14.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl2fm3 T A 3: 59,776,380 (GRCm39) C184S probably damaging Het
Acadm G T 3: 153,644,698 (GRCm39) S9* probably null Het
Acot10 C T 15: 20,665,629 (GRCm39) V371I possibly damaging Het
Adam8 T C 7: 139,568,903 (GRCm39) E199G probably damaging Het
Aldh18a1 A T 19: 40,539,696 (GRCm39) W762R probably damaging Het
Aldh1a1 T A 19: 20,599,075 (GRCm39) V162E probably damaging Het
Alms1 A G 6: 85,618,432 (GRCm39) D2357G probably damaging Het
Arfgef1 G T 1: 10,254,685 (GRCm39) Q718K probably damaging Het
Arid5b A C 10: 68,079,007 (GRCm39) V110G possibly damaging Het
Bpifb3 T A 2: 153,761,654 (GRCm39) D34E probably damaging Het
Cacfd1 C T 2: 26,905,558 (GRCm39) A85V possibly damaging Het
Cep57l1 C A 10: 41,597,596 (GRCm39) S345I probably benign Het
Cibar2 T C 8: 120,901,589 (GRCm39) T39A probably damaging Het
Clca3b G A 3: 144,542,417 (GRCm39) R462* probably null Het
Cyp26c1 G A 19: 37,677,323 (GRCm39) V251I probably benign Het
Dip2a A G 10: 76,110,080 (GRCm39) S1179P possibly damaging Het
Dnal1 T C 12: 84,173,780 (GRCm39) L27P probably damaging Het
Dock7 A G 4: 98,864,180 (GRCm39) V1288A unknown Het
Elmod1 A T 9: 53,841,508 (GRCm39) probably null Het
Epb41l5 T G 1: 119,551,679 (GRCm39) K102T probably damaging Het
Fermt3 T C 19: 6,980,406 (GRCm39) I358V probably benign Het
Frmd3 A G 4: 74,079,955 (GRCm39) I316V probably benign Het
Fryl T C 5: 73,204,839 (GRCm39) probably null Het
Gm4131 T A 14: 62,702,356 (GRCm39) H204L possibly damaging Het
Hmcn2 G A 2: 31,325,806 (GRCm39) G4278R probably damaging Het
Hmcn2 A G 2: 31,343,147 (GRCm39) S4558G possibly damaging Het
Igkv1-132 A G 6: 67,737,108 (GRCm39) T25A probably benign Het
Kcp T C 6: 29,485,511 (GRCm39) E1161G probably damaging Het
Macf1 A T 4: 123,293,235 (GRCm39) I5371K probably damaging Het
Malrd1 T A 2: 16,011,529 (GRCm39) C1670S probably damaging Het
Mfsd13a T A 19: 46,356,809 (GRCm39) V270E probably damaging Het
Mroh1 A G 15: 76,311,838 (GRCm39) I524V probably benign Het
Myo7a C T 7: 97,728,573 (GRCm39) R800H probably benign Het
Ncald T A 15: 37,397,524 (GRCm39) Y52F probably damaging Het
Nherf1 C T 11: 115,054,593 (GRCm39) A81V possibly damaging Het
Nomo1 T C 7: 45,732,692 (GRCm39) S1152P probably damaging Het
Nr3c1 A G 18: 39,620,090 (GRCm39) F66L probably benign Het
Nrf1 T C 6: 30,118,970 (GRCm39) L363S probably benign Het
Or4n4 C A 14: 50,519,036 (GRCm39) V225F probably benign Het
Or8b12b A T 9: 37,684,293 (GRCm39) I113F probably damaging Het
Osbpl3 A G 6: 50,321,886 (GRCm39) M300T possibly damaging Het
Parpbp T A 10: 87,947,617 (GRCm39) N339I probably damaging Het
Pdlim5 A T 3: 141,950,678 (GRCm39) H578Q probably damaging Het
Pear1 T C 3: 87,657,532 (GRCm39) N1009S probably damaging Het
Pnpla8 A G 12: 44,358,286 (GRCm39) I745M probably damaging Het
Pom121l12 C A 11: 14,549,681 (GRCm39) T129K probably damaging Het
Ppp1r14a T C 7: 28,992,687 (GRCm39) S130P probably damaging Het
Prss12 A C 3: 123,280,780 (GRCm39) L488F probably benign Het
Psd3 C T 8: 68,361,357 (GRCm39) V559I possibly damaging Het
Rrh T C 3: 129,602,631 (GRCm39) T364A probably benign Het
Shcbp1 A C 8: 4,804,310 (GRCm39) F200C probably damaging Het
Shcbp1 A T 8: 4,791,876 (GRCm39) M479K probably damaging Het
Slx1b G T 7: 126,291,699 (GRCm39) R122S probably damaging Het
Spata31f1e G A 4: 42,793,856 (GRCm39) T92I possibly damaging Het
Spidr A G 16: 15,932,689 (GRCm39) probably null Het
St18 G A 1: 6,872,783 (GRCm39) D173N probably benign Het
Stambpl1 T C 19: 34,204,048 (GRCm39) I46T probably damaging Het
Syne1 C T 10: 5,007,886 (GRCm39) D113N probably damaging Het
Tg G A 15: 66,597,121 (GRCm39) V1741I probably benign Het
Thsd7b T A 1: 130,123,012 (GRCm39) W1544R probably benign Het
Tiam2 G A 17: 3,553,283 (GRCm39) R1120H possibly damaging Het
Tinag A T 9: 76,908,931 (GRCm39) C337S probably damaging Het
Tm4sf1 G C 3: 57,200,510 (GRCm39) A64G probably damaging Het
Tmprss6 A G 15: 78,328,017 (GRCm39) Y572H unknown Het
Tnfrsf11a G A 1: 105,754,854 (GRCm39) A309T possibly damaging Het
Txndc11 A G 16: 10,946,425 (GRCm39) Y129H probably damaging Het
Ube3b T C 5: 114,553,742 (GRCm39) F974S possibly damaging Het
Utrn C A 10: 12,603,753 (GRCm39) probably null Het
Vmn1r58 T A 7: 5,414,066 (GRCm39) M55L probably benign Het
Vnn1 T A 10: 23,776,658 (GRCm39) S336R probably benign Het
Wwc2 T C 8: 48,322,829 (GRCm39) Y424C unknown Het
Zfp507 T C 7: 35,475,505 (GRCm39) I903V probably damaging Het
Zfp551 C T 7: 12,150,681 (GRCm39) G243R probably damaging Het
Zfp60 T A 7: 27,448,444 (GRCm39) C371S probably damaging Het
Other mutations in Mta1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02227:Mta1 APN 12 113,084,528 (GRCm39) missense possibly damaging 0.94
IGL02250:Mta1 APN 12 113,090,418 (GRCm39) missense possibly damaging 0.59
IGL02391:Mta1 APN 12 113,100,203 (GRCm39) missense possibly damaging 0.79
IGL02670:Mta1 APN 12 113,093,741 (GRCm39) missense probably damaging 1.00
PIT4382001:Mta1 UTSW 12 113,096,870 (GRCm39) missense probably benign 0.06
R0361:Mta1 UTSW 12 113,096,961 (GRCm39) splice site probably null
R0496:Mta1 UTSW 12 113,094,941 (GRCm39) nonsense probably null
R1774:Mta1 UTSW 12 113,091,659 (GRCm39) missense probably damaging 1.00
R1870:Mta1 UTSW 12 113,091,694 (GRCm39) missense possibly damaging 0.73
R1976:Mta1 UTSW 12 113,099,926 (GRCm39) missense probably damaging 0.97
R2110:Mta1 UTSW 12 113,095,248 (GRCm39) missense probably damaging 1.00
R2111:Mta1 UTSW 12 113,095,248 (GRCm39) missense probably damaging 1.00
R2184:Mta1 UTSW 12 113,093,815 (GRCm39) critical splice donor site probably null
R2274:Mta1 UTSW 12 113,091,770 (GRCm39) missense probably damaging 1.00
R4087:Mta1 UTSW 12 113,075,802 (GRCm39) missense probably damaging 1.00
R4231:Mta1 UTSW 12 113,099,447 (GRCm39) missense possibly damaging 0.95
R4916:Mta1 UTSW 12 113,100,160 (GRCm39) missense probably benign 0.17
R5032:Mta1 UTSW 12 113,097,145 (GRCm39) splice site probably null
R5271:Mta1 UTSW 12 113,095,577 (GRCm39) missense probably damaging 0.99
R5344:Mta1 UTSW 12 113,095,186 (GRCm39) splice site probably benign
R5392:Mta1 UTSW 12 113,096,856 (GRCm39) missense probably benign
R5656:Mta1 UTSW 12 113,086,759 (GRCm39) missense probably damaging 1.00
R5903:Mta1 UTSW 12 113,100,239 (GRCm39) missense probably damaging 1.00
R6168:Mta1 UTSW 12 113,086,739 (GRCm39) missense probably damaging 0.96
R7091:Mta1 UTSW 12 113,100,022 (GRCm39) missense probably damaging 1.00
R7408:Mta1 UTSW 12 113,095,088 (GRCm39) critical splice donor site probably null
R7889:Mta1 UTSW 12 113,095,308 (GRCm39) missense probably benign 0.02
R8136:Mta1 UTSW 12 113,095,298 (GRCm39) missense probably damaging 1.00
R8176:Mta1 UTSW 12 113,084,456 (GRCm39) missense probably benign 0.00
R8385:Mta1 UTSW 12 113,095,085 (GRCm39) missense probably benign
R8398:Mta1 UTSW 12 113,095,242 (GRCm39) missense possibly damaging 0.83
R9132:Mta1 UTSW 12 113,100,025 (GRCm39) missense probably damaging 1.00
R9159:Mta1 UTSW 12 113,100,025 (GRCm39) missense probably damaging 1.00
R9418:Mta1 UTSW 12 113,094,987 (GRCm39) missense probably damaging 1.00
R9489:Mta1 UTSW 12 113,095,085 (GRCm39) missense probably benign
R9596:Mta1 UTSW 12 113,090,470 (GRCm39) missense probably damaging 0.99
R9682:Mta1 UTSW 12 113,095,384 (GRCm39) critical splice donor site probably null
Z1088:Mta1 UTSW 12 113,096,820 (GRCm39) missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- CAAGAGCAGAGTACCTGACC -3'
(R):5'- ACAGGGATAAGACCATGGACCC -3'

Sequencing Primer
(F):5'- GAGCAGAGTACCTGACCCCTAC -3'
(R):5'- GGACCCCCATATTGGATGTAC -3'
Posted On 2019-09-13