Incidental Mutation 'R7334:Olfr732'
ID 569390
Institutional Source Beutler Lab
Gene Symbol Olfr732
Ensembl Gene ENSMUSG00000091873
Gene Name olfactory receptor 732
Synonyms GA_x6K02T2PMLR-5975274-5974348, MOR241-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.120) question?
Stock # R7334 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 50278473-50284206 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 50281579 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Phenylalanine at position 225 (V225F)
Ref Sequence ENSEMBL: ENSMUSP00000148984 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071208] [ENSMUST00000213701]
AlphaFold Q8VFT5
Predicted Effect probably benign
Transcript: ENSMUST00000071208
AA Change: V225F

PolyPhen 2 Score 0.084 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000071195
Gene: ENSMUSG00000091873
AA Change: V225F

DomainStartEndE-ValueType
Pfam:7tm_4 30 305 7.4e-45 PFAM
Pfam:7tm_1 41 288 4.5e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213701
AA Change: V225F

PolyPhen 2 Score 0.084 (Sensitivity: 0.93; Specificity: 0.85)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (75/76)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadm G T 3: 153,939,061 S9* probably null Het
Acot10 C T 15: 20,665,543 V371I possibly damaging Het
Adam8 T C 7: 139,988,990 E199G probably damaging Het
Aldh18a1 A T 19: 40,551,252 W762R probably damaging Het
Aldh1a1 T A 19: 20,621,711 V162E probably damaging Het
Alms1 A G 6: 85,641,450 D2357G probably damaging Het
Arfgef1 G T 1: 10,184,460 Q718K probably damaging Het
Arid5b A C 10: 68,243,177 V110G possibly damaging Het
Bpifb3 T A 2: 153,919,734 D34E probably damaging Het
Cacfd1 C T 2: 27,015,546 A85V possibly damaging Het
Cep57l1 C A 10: 41,721,600 S345I probably benign Het
Clca3b G A 3: 144,836,656 R462* probably null Het
Cyp26c1 G A 19: 37,688,875 V251I probably benign Het
Dip2a A G 10: 76,274,246 S1179P possibly damaging Het
Dnal1 T C 12: 84,127,006 L27P probably damaging Het
Dock7 A G 4: 98,975,943 V1288A unknown Het
Elmod1 A T 9: 53,934,224 probably null Het
Epb41l5 T G 1: 119,623,949 K102T probably damaging Het
Fam92b T C 8: 120,174,850 T39A probably damaging Het
Fermt3 T C 19: 7,003,038 I358V probably benign Het
Frmd3 A G 4: 74,161,718 I316V probably benign Het
Fryl T C 5: 73,047,496 probably null Het
Gm12394 G A 4: 42,793,856 T92I possibly damaging Het
Gm4131 T A 14: 62,464,907 H204L possibly damaging Het
Gm8298 T A 3: 59,868,959 C184S probably damaging Het
Hmcn2 G A 2: 31,435,794 G4278R probably damaging Het
Hmcn2 A G 2: 31,453,135 S4558G possibly damaging Het
Igkv1-132 A G 6: 67,760,124 T25A probably benign Het
Kcp T C 6: 29,485,512 E1161G probably damaging Het
Macf1 A T 4: 123,399,442 I5371K probably damaging Het
Malrd1 T A 2: 16,006,718 C1670S probably damaging Het
Mfsd13a T A 19: 46,368,370 V270E probably damaging Het
Mroh1 A G 15: 76,427,638 I524V probably benign Het
Mta1 T C 12: 113,126,798 S175P possibly damaging Het
Myo7a C T 7: 98,079,366 R800H probably benign Het
Ncald T A 15: 37,397,280 Y52F probably damaging Het
Nomo1 T C 7: 46,083,268 S1152P probably damaging Het
Nr3c1 A G 18: 39,487,037 F66L probably benign Het
Nrf1 T C 6: 30,118,971 L363S probably benign Het
Olfr875 A T 9: 37,772,997 I113F probably damaging Het
Osbpl3 A G 6: 50,344,906 M300T possibly damaging Het
Parpbp T A 10: 88,111,755 N339I probably damaging Het
Pdlim5 A T 3: 142,244,917 H578Q probably damaging Het
Pear1 T C 3: 87,750,225 N1009S probably damaging Het
Pnpla8 A G 12: 44,311,503 I745M probably damaging Het
Pom121l12 C A 11: 14,599,681 T129K probably damaging Het
Ppp1r14a T C 7: 29,293,262 S130P probably damaging Het
Prss12 A C 3: 123,487,131 L488F probably benign Het
Psd3 C T 8: 67,908,705 V559I possibly damaging Het
Rrh T C 3: 129,808,982 T364A probably benign Het
Shcbp1 A T 8: 4,741,876 M479K probably damaging Het
Shcbp1 A C 8: 4,754,310 F200C probably damaging Het
Slc9a3r1 C T 11: 115,163,767 A81V possibly damaging Het
Slx1b G T 7: 126,692,527 R122S probably damaging Het
Spidr A G 16: 16,114,825 probably null Het
St18 G A 1: 6,802,559 D173N probably benign Het
Stambpl1 T C 19: 34,226,648 I46T probably damaging Het
Syne1 C T 10: 5,057,886 D113N probably damaging Het
Tg G A 15: 66,725,272 V1741I probably benign Het
Thsd7b T A 1: 130,195,275 W1544R probably benign Het
Tiam2 G A 17: 3,503,008 R1120H possibly damaging Het
Tinag A T 9: 77,001,649 C337S probably damaging Het
Tm4sf1 G C 3: 57,293,089 A64G probably damaging Het
Tmprss6 A G 15: 78,443,817 Y572H unknown Het
Tnfrsf11a G A 1: 105,827,129 A309T possibly damaging Het
Txndc11 A G 16: 11,128,561 Y129H probably damaging Het
Ube3b T C 5: 114,415,681 F974S possibly damaging Het
Utrn C A 10: 12,728,009 probably null Het
Vmn1r58 T A 7: 5,411,067 M55L probably benign Het
Vnn1 T A 10: 23,900,760 S336R probably benign Het
Wwc2 T C 8: 47,869,794 Y424C unknown Het
Zfp507 T C 7: 35,776,080 I903V probably damaging Het
Zfp551 C T 7: 12,416,754 G243R probably damaging Het
Zfp60 T A 7: 27,749,019 C371S probably damaging Het
Other mutations in Olfr732
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01370:Olfr732 APN 14 50282232 missense probably damaging 0.99
IGL01801:Olfr732 APN 14 50282208 missense probably benign
IGL01992:Olfr732 APN 14 50281341 missense probably benign 0.09
IGL02137:Olfr732 APN 14 50281678 missense probably benign 0.16
IGL02494:Olfr732 APN 14 50282226 missense probably damaging 1.00
IGL02606:Olfr732 APN 14 50282073 missense probably damaging 1.00
IGL02799:Olfr732 UTSW 14 50281344 missense probably benign
PIT4142001:Olfr732 UTSW 14 50281327 makesense probably null
R0570:Olfr732 UTSW 14 50281913 missense probably benign 0.00
R1570:Olfr732 UTSW 14 50281524 missense probably damaging 1.00
R1860:Olfr732 UTSW 14 50281391 nonsense probably null
R2313:Olfr732 UTSW 14 50281974 missense probably damaging 1.00
R4594:Olfr732 UTSW 14 50281683 missense probably benign 0.02
R6442:Olfr732 UTSW 14 50281369 missense probably damaging 0.98
R6783:Olfr732 UTSW 14 50282187 missense probably benign
R7763:Olfr732 UTSW 14 50281488 missense probably damaging 1.00
R8207:Olfr732 UTSW 14 50281579 missense probably benign 0.02
R8228:Olfr732 UTSW 14 50281540 missense probably damaging 1.00
R8806:Olfr732 UTSW 14 50281779 missense probably benign 0.04
R8809:Olfr732 UTSW 14 50281779 missense probably benign 0.04
R8898:Olfr732 UTSW 14 50281495 missense probably damaging 1.00
R8962:Olfr732 UTSW 14 50281359 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GGTATAAATCACAGGATTCATCAGTGG -3'
(R):5'- CTGGCTTGGAGGATTTATTCAC -3'

Sequencing Primer
(F):5'- ACAGGATTCATCAGTGGAAATATTAC -3'
(R):5'- TGGAGGATTTATTCACTCCATTATTC -3'
Posted On 2019-09-13