Incidental Mutation 'R7334:Tiam2'
ID569399
Institutional Source Beutler Lab
Gene Symbol Tiam2
Ensembl Gene ENSMUSG00000023800
Gene NameT cell lymphoma invasion and metastasis 2
Synonyms3000002F19Rik, STEF
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7334 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location3326573-3531344 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 3503008 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 1120 (R1120H)
Ref Sequence ENSEMBL: ENSMUSP00000072020 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072156] [ENSMUST00000169838] [ENSMUST00000227405] [ENSMUST00000227604]
PDB Structure
Crystal structure of the Tiam2 PHCCEx domain [X-RAY DIFFRACTION]
Low-resolution crystal structure of the Tiam2 PHCCEx domain [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000072156
AA Change: R1120H

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000072020
Gene: ENSMUSG00000023800
AA Change: R1120H

DomainStartEndE-ValueType
low complexity region 230 245 N/A INTRINSIC
low complexity region 267 281 N/A INTRINSIC
low complexity region 471 492 N/A INTRINSIC
PH 505 620 7.82e-16 SMART
RBD 831 902 1.32e-26 SMART
PDZ 921 995 2.38e-7 SMART
RhoGEF 1124 1313 2.23e-61 SMART
PH 1347 1478 2.86e0 SMART
low complexity region 1522 1532 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000169838
AA Change: R1120H

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000125842
Gene: ENSMUSG00000023800
AA Change: R1120H

DomainStartEndE-ValueType
low complexity region 230 245 N/A INTRINSIC
low complexity region 267 281 N/A INTRINSIC
low complexity region 471 492 N/A INTRINSIC
PH 505 620 7.82e-16 SMART
RBD 831 902 1.32e-26 SMART
PDZ 921 995 2.38e-7 SMART
RhoGEF 1124 1313 2.23e-61 SMART
PH 1347 1478 2.86e0 SMART
low complexity region 1522 1532 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000227405
AA Change: R113H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000227604
AA Change: R47H

PolyPhen 2 Score 0.065 (Sensitivity: 0.94; Specificity: 0.84)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (75/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a guanine nucleotide exchange factor. A highly similar mouse protein specifically activates ras-related C3 botulinum substrate 1, converting this Rho-like guanosine triphosphatase (GTPase) from a guanosine diphosphate-bound inactive state to a guanosine triphosphate-bound active state. The encoded protein may play a role in neural cell development. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadm G T 3: 153,939,061 S9* probably null Het
Acot10 C T 15: 20,665,543 V371I possibly damaging Het
Adam8 T C 7: 139,988,990 E199G probably damaging Het
Aldh18a1 A T 19: 40,551,252 W762R probably damaging Het
Aldh1a1 T A 19: 20,621,711 V162E probably damaging Het
Alms1 A G 6: 85,641,450 D2357G probably damaging Het
Arfgef1 G T 1: 10,184,460 Q718K probably damaging Het
Arid5b A C 10: 68,243,177 V110G possibly damaging Het
Bpifb3 T A 2: 153,919,734 D34E probably damaging Het
Cacfd1 C T 2: 27,015,546 A85V possibly damaging Het
Cep57l1 C A 10: 41,721,600 S345I probably benign Het
Clca3b G A 3: 144,836,656 R462* probably null Het
Cyp26c1 G A 19: 37,688,875 V251I probably benign Het
Dip2a A G 10: 76,274,246 S1179P possibly damaging Het
Dnal1 T C 12: 84,127,006 L27P probably damaging Het
Dock7 A G 4: 98,975,943 V1288A unknown Het
Elmod1 A T 9: 53,934,224 probably null Het
Epb41l5 T G 1: 119,623,949 K102T probably damaging Het
Fam92b T C 8: 120,174,850 T39A probably damaging Het
Fermt3 T C 19: 7,003,038 I358V probably benign Het
Frmd3 A G 4: 74,161,718 I316V probably benign Het
Fryl T C 5: 73,047,496 probably null Het
Gm12394 G A 4: 42,793,856 T92I possibly damaging Het
Gm4131 T A 14: 62,464,907 H204L possibly damaging Het
Gm8298 T A 3: 59,868,959 C184S probably damaging Het
Hmcn2 G A 2: 31,435,794 G4278R probably damaging Het
Hmcn2 A G 2: 31,453,135 S4558G possibly damaging Het
Igkv1-132 A G 6: 67,760,124 T25A probably benign Het
Kcp T C 6: 29,485,512 E1161G probably damaging Het
Macf1 A T 4: 123,399,442 I5371K probably damaging Het
Malrd1 T A 2: 16,006,718 C1670S probably damaging Het
Mfsd13a T A 19: 46,368,370 V270E probably damaging Het
Mroh1 A G 15: 76,427,638 I524V probably benign Het
Mta1 T C 12: 113,126,798 S175P possibly damaging Het
Myo7a C T 7: 98,079,366 R800H probably benign Het
Ncald T A 15: 37,397,280 Y52F probably damaging Het
Nomo1 T C 7: 46,083,268 S1152P probably damaging Het
Nr3c1 A G 18: 39,487,037 F66L probably benign Het
Nrf1 T C 6: 30,118,971 L363S probably benign Het
Olfr732 C A 14: 50,281,579 V225F probably benign Het
Olfr875 A T 9: 37,772,997 I113F probably damaging Het
Osbpl3 A G 6: 50,344,906 M300T possibly damaging Het
Parpbp T A 10: 88,111,755 N339I probably damaging Het
Pdlim5 A T 3: 142,244,917 H578Q probably damaging Het
Pear1 T C 3: 87,750,225 N1009S probably damaging Het
Pnpla8 A G 12: 44,311,503 I745M probably damaging Het
Pom121l12 C A 11: 14,599,681 T129K probably damaging Het
Ppp1r14a T C 7: 29,293,262 S130P probably damaging Het
Prss12 A C 3: 123,487,131 L488F probably benign Het
Psd3 C T 8: 67,908,705 V559I possibly damaging Het
Rrh T C 3: 129,808,982 T364A probably benign Het
Shcbp1 A T 8: 4,741,876 M479K probably damaging Het
Shcbp1 A C 8: 4,754,310 F200C probably damaging Het
Slc9a3r1 C T 11: 115,163,767 A81V possibly damaging Het
Slx1b G T 7: 126,692,527 R122S probably damaging Het
Spidr A G 16: 16,114,825 probably null Het
St18 G A 1: 6,802,559 D173N probably benign Het
Stambpl1 T C 19: 34,226,648 I46T probably damaging Het
Syne1 C T 10: 5,057,886 D113N probably damaging Het
Tg G A 15: 66,725,272 V1741I probably benign Het
Thsd7b T A 1: 130,195,275 W1544R probably benign Het
Tinag A T 9: 77,001,649 C337S probably damaging Het
Tm4sf1 G C 3: 57,293,089 A64G probably damaging Het
Tmprss6 A G 15: 78,443,817 Y572H unknown Het
Tnfrsf11a G A 1: 105,827,129 A309T possibly damaging Het
Txndc11 A G 16: 11,128,561 Y129H probably damaging Het
Ube3b T C 5: 114,415,681 F974S possibly damaging Het
Utrn C A 10: 12,728,009 probably null Het
Vmn1r58 T A 7: 5,411,067 M55L probably benign Het
Vnn1 T A 10: 23,900,760 S336R probably benign Het
Wwc2 T C 8: 47,869,794 Y424C unknown Het
Zfp507 T C 7: 35,776,080 I903V probably damaging Het
Zfp551 C T 7: 12,416,754 G243R probably damaging Het
Zfp60 T A 7: 27,749,019 C371S probably damaging Het
Other mutations in Tiam2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01011:Tiam2 APN 17 3415028 missense probably benign 0.21
IGL01320:Tiam2 APN 17 3505745 missense probably damaging 1.00
IGL01384:Tiam2 APN 17 3427202 missense probably benign 0.08
IGL01575:Tiam2 APN 17 3454316 missense probably damaging 1.00
IGL01769:Tiam2 APN 17 3427290 missense probably damaging 1.00
IGL02395:Tiam2 APN 17 3421481 missense possibly damaging 0.49
IGL02652:Tiam2 APN 17 3439696 splice site probably benign
IGL03102:Tiam2 APN 17 3509548 missense probably damaging 1.00
IGL03222:Tiam2 APN 17 3438708 missense probably damaging 0.97
Feste_burg UTSW 17 3414622 frame shift probably null
R0257:Tiam2 UTSW 17 3450813 missense possibly damaging 0.49
R0420:Tiam2 UTSW 17 3502918 missense probably benign 0.01
R0528:Tiam2 UTSW 17 3511071 missense probably damaging 1.00
R0532:Tiam2 UTSW 17 3421646 missense probably damaging 1.00
R0551:Tiam2 UTSW 17 3428954 missense probably damaging 1.00
R0554:Tiam2 UTSW 17 3438681 nonsense probably null
R0645:Tiam2 UTSW 17 3514698 missense possibly damaging 0.92
R0726:Tiam2 UTSW 17 3512833 unclassified probably benign
R1139:Tiam2 UTSW 17 3477267 missense possibly damaging 0.55
R1392:Tiam2 UTSW 17 3414197 missense possibly damaging 0.71
R1392:Tiam2 UTSW 17 3414197 missense possibly damaging 0.71
R1529:Tiam2 UTSW 17 3516703 missense probably benign 0.00
R1671:Tiam2 UTSW 17 3506834 missense probably damaging 1.00
R1731:Tiam2 UTSW 17 3518423 missense probably damaging 0.98
R1759:Tiam2 UTSW 17 3516003 missense probably damaging 0.98
R1850:Tiam2 UTSW 17 3437235 missense probably damaging 1.00
R1853:Tiam2 UTSW 17 3415135 missense probably damaging 1.00
R1855:Tiam2 UTSW 17 3415135 missense probably damaging 1.00
R1931:Tiam2 UTSW 17 3514725 missense possibly damaging 0.68
R1932:Tiam2 UTSW 17 3514725 missense possibly damaging 0.68
R1993:Tiam2 UTSW 17 3415126 nonsense probably null
R2211:Tiam2 UTSW 17 3414918 nonsense probably null
R2217:Tiam2 UTSW 17 3415114 missense probably benign 0.34
R2278:Tiam2 UTSW 17 3427220 missense probably damaging 0.96
R2407:Tiam2 UTSW 17 3477261 missense probably benign 0.14
R2516:Tiam2 UTSW 17 3453382 missense probably damaging 1.00
R2991:Tiam2 UTSW 17 3518250 missense probably benign
R3086:Tiam2 UTSW 17 3421582 missense probably damaging 1.00
R3121:Tiam2 UTSW 17 3439702 missense probably benign 0.01
R3686:Tiam2 UTSW 17 3421684 missense possibly damaging 0.87
R3740:Tiam2 UTSW 17 3414113 missense possibly damaging 0.54
R3742:Tiam2 UTSW 17 3414113 missense possibly damaging 0.54
R3826:Tiam2 UTSW 17 3507701 splice site probably benign
R3829:Tiam2 UTSW 17 3507701 splice site probably benign
R3844:Tiam2 UTSW 17 3421651 missense probably damaging 0.98
R3970:Tiam2 UTSW 17 3428831 missense probably damaging 1.00
R4060:Tiam2 UTSW 17 3428980 missense probably benign 0.00
R4296:Tiam2 UTSW 17 3450845 missense probably benign
R4357:Tiam2 UTSW 17 3450853 missense probably damaging 1.00
R4368:Tiam2 UTSW 17 3414683 missense probably benign 0.01
R4369:Tiam2 UTSW 17 3413967 start gained probably benign
R4524:Tiam2 UTSW 17 3514711 missense probably damaging 1.00
R4619:Tiam2 UTSW 17 3518342 missense probably damaging 1.00
R4715:Tiam2 UTSW 17 3454168 missense probably damaging 1.00
R4723:Tiam2 UTSW 17 3450317 missense probably benign 0.00
R4979:Tiam2 UTSW 17 3505710 missense probably damaging 1.00
R5182:Tiam2 UTSW 17 3438721 missense probably damaging 1.00
R5451:Tiam2 UTSW 17 3428996 missense probably damaging 1.00
R5728:Tiam2 UTSW 17 3414956 missense probably damaging 0.99
R5827:Tiam2 UTSW 17 3448489 missense probably benign 0.00
R5879:Tiam2 UTSW 17 3437265 missense probably damaging 1.00
R5960:Tiam2 UTSW 17 3438640 missense probably benign 0.24
R5974:Tiam2 UTSW 17 3414809 missense possibly damaging 0.51
R6198:Tiam2 UTSW 17 3414121 missense probably benign 0.06
R6222:Tiam2 UTSW 17 3453338 missense probably damaging 0.96
R6295:Tiam2 UTSW 17 3509556 missense probably damaging 1.00
R6355:Tiam2 UTSW 17 3414622 frame shift probably null
R6356:Tiam2 UTSW 17 3414622 frame shift probably null
R6454:Tiam2 UTSW 17 3438663 missense probably benign 0.00
R6497:Tiam2 UTSW 17 3506827 missense probably damaging 1.00
R6579:Tiam2 UTSW 17 3414622 frame shift probably null
R6580:Tiam2 UTSW 17 3414622 frame shift probably null
R6581:Tiam2 UTSW 17 3414622 frame shift probably null
R6582:Tiam2 UTSW 17 3414622 frame shift probably null
R6648:Tiam2 UTSW 17 3506873 missense probably damaging 1.00
R6705:Tiam2 UTSW 17 3518243 missense probably benign 0.01
R6758:Tiam2 UTSW 17 3518403 missense probably benign 0.01
R6836:Tiam2 UTSW 17 3414380 missense probably benign 0.17
R6924:Tiam2 UTSW 17 3507795 missense probably damaging 1.00
R6977:Tiam2 UTSW 17 3518659 missense probably damaging 1.00
R7051:Tiam2 UTSW 17 3448483 missense probably damaging 0.99
R7151:Tiam2 UTSW 17 3448385 missense probably benign 0.36
R7214:Tiam2 UTSW 17 3518412 missense possibly damaging 0.85
R7332:Tiam2 UTSW 17 3453369 missense probably damaging 1.00
R7414:Tiam2 UTSW 17 3414113 missense possibly damaging 0.54
R7660:Tiam2 UTSW 17 3482605 start codon destroyed probably null 0.66
R7743:Tiam2 UTSW 17 3518156 missense possibly damaging 0.53
R7755:Tiam2 UTSW 17 3421316 missense probably benign 0.01
R7805:Tiam2 UTSW 17 3509410 missense probably damaging 1.00
R7813:Tiam2 UTSW 17 3437247 missense probably damaging 1.00
R7842:Tiam2 UTSW 17 3518124 missense possibly damaging 0.82
R7989:Tiam2 UTSW 17 3518249 nonsense probably null
R8011:Tiam2 UTSW 17 3448396 missense possibly damaging 0.92
R8221:Tiam2 UTSW 17 3518585 missense probably damaging 0.99
R8260:Tiam2 UTSW 17 3518319 missense possibly damaging 0.94
R8292:Tiam2 UTSW 17 3506867 missense probably benign 0.01
R8406:Tiam2 UTSW 17 3507790 missense possibly damaging 0.94
R8424:Tiam2 UTSW 17 3516041 missense probably damaging 1.00
R8424:Tiam2 UTSW 17 3516042 missense probably damaging 1.00
R8430:Tiam2 UTSW 17 3518262 missense probably benign 0.05
R8530:Tiam2 UTSW 17 3450812
X0027:Tiam2 UTSW 17 3414000 start codon destroyed probably null 1.00
X0060:Tiam2 UTSW 17 3450354 splice site probably null
X0065:Tiam2 UTSW 17 3505708 missense probably damaging 1.00
Z1088:Tiam2 UTSW 17 3415019 missense probably benign 0.01
Z1176:Tiam2 UTSW 17 3505776 missense probably null 1.00
Z1177:Tiam2 UTSW 17 3427263 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTTGGTGCAGATGAAACAC -3'
(R):5'- TCAGGGAGCACATGTCTACATC -3'

Sequencing Primer
(F):5'- TCTAGGTGAGGTGCATATACAACAC -3'
(R):5'- GAGCACATGTCTACATCCTGAGTG -3'
Posted On2019-09-13