Incidental Mutation 'R7334:Fermt3'
ID569402
Institutional Source Beutler Lab
Gene Symbol Fermt3
Ensembl Gene ENSMUSG00000024965
Gene Namefermitin family member 3
SynonymsKindlin-3, C79673
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7334 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location6998958-7019469 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 7003038 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 358 (I358V)
Ref Sequence ENSEMBL: ENSMUSP00000037858 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040772] [ENSMUST00000088223]
Predicted Effect probably benign
Transcript: ENSMUST00000040772
AA Change: I358V

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000037858
Gene: ENSMUSG00000024965
AA Change: I358V

DomainStartEndE-ValueType
Blast:B41 14 77 6e-32 BLAST
B41 94 556 1.66e-28 SMART
PH 350 455 2.26e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000088223
SMART Domains Protein: ENSMUSP00000085555
Gene: ENSMUSG00000047656

DomainStartEndE-ValueType
Pfam:PTS_2-RNA 21 198 2.6e-67 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (75/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Kindlins are a small family of proteins that mediate protein-protein interactions involved in integrin activation and thereby have a role in cell adhesion, migration, differentiation, and proliferation. The protein encoded by this gene has a key role in the regulation of hemostasis and thrombosis. This protein may also help maintain the membrane skeleton of erythrocytes. Mutations in this gene cause the autosomal recessive leukocyte adhesion deficiency syndrome-III (LAD-III). Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jan 2010]
PHENOTYPE: Disruption of this marker results in lethality in the first week after birth, abnormal erythropoiesis and platelet function, and severe hemorrhage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadm G T 3: 153,939,061 S9* probably null Het
Acot10 C T 15: 20,665,543 V371I possibly damaging Het
Adam8 T C 7: 139,988,990 E199G probably damaging Het
Aldh18a1 A T 19: 40,551,252 W762R probably damaging Het
Aldh1a1 T A 19: 20,621,711 V162E probably damaging Het
Alms1 A G 6: 85,641,450 D2357G probably damaging Het
Arfgef1 G T 1: 10,184,460 Q718K probably damaging Het
Arid5b A C 10: 68,243,177 V110G possibly damaging Het
Bpifb3 T A 2: 153,919,734 D34E probably damaging Het
Cacfd1 C T 2: 27,015,546 A85V possibly damaging Het
Cep57l1 C A 10: 41,721,600 S345I probably benign Het
Clca3b G A 3: 144,836,656 R462* probably null Het
Cyp26c1 G A 19: 37,688,875 V251I probably benign Het
Dip2a A G 10: 76,274,246 S1179P possibly damaging Het
Dnal1 T C 12: 84,127,006 L27P probably damaging Het
Dock7 A G 4: 98,975,943 V1288A unknown Het
Elmod1 A T 9: 53,934,224 probably null Het
Epb41l5 T G 1: 119,623,949 K102T probably damaging Het
Fam92b T C 8: 120,174,850 T39A probably damaging Het
Frmd3 A G 4: 74,161,718 I316V probably benign Het
Fryl T C 5: 73,047,496 probably null Het
Gm12394 G A 4: 42,793,856 T92I possibly damaging Het
Gm4131 T A 14: 62,464,907 H204L possibly damaging Het
Gm8298 T A 3: 59,868,959 C184S probably damaging Het
Hmcn2 G A 2: 31,435,794 G4278R probably damaging Het
Hmcn2 A G 2: 31,453,135 S4558G possibly damaging Het
Igkv1-132 A G 6: 67,760,124 T25A probably benign Het
Kcp T C 6: 29,485,512 E1161G probably damaging Het
Macf1 A T 4: 123,399,442 I5371K probably damaging Het
Malrd1 T A 2: 16,006,718 C1670S probably damaging Het
Mfsd13a T A 19: 46,368,370 V270E probably damaging Het
Mroh1 A G 15: 76,427,638 I524V probably benign Het
Mta1 T C 12: 113,126,798 S175P possibly damaging Het
Myo7a C T 7: 98,079,366 R800H probably benign Het
Ncald T A 15: 37,397,280 Y52F probably damaging Het
Nomo1 T C 7: 46,083,268 S1152P probably damaging Het
Nr3c1 A G 18: 39,487,037 F66L probably benign Het
Nrf1 T C 6: 30,118,971 L363S probably benign Het
Olfr732 C A 14: 50,281,579 V225F probably benign Het
Olfr875 A T 9: 37,772,997 I113F probably damaging Het
Osbpl3 A G 6: 50,344,906 M300T possibly damaging Het
Parpbp T A 10: 88,111,755 N339I probably damaging Het
Pdlim5 A T 3: 142,244,917 H578Q probably damaging Het
Pear1 T C 3: 87,750,225 N1009S probably damaging Het
Pnpla8 A G 12: 44,311,503 I745M probably damaging Het
Pom121l12 C A 11: 14,599,681 T129K probably damaging Het
Ppp1r14a T C 7: 29,293,262 S130P probably damaging Het
Prss12 A C 3: 123,487,131 L488F probably benign Het
Psd3 C T 8: 67,908,705 V559I possibly damaging Het
Rrh T C 3: 129,808,982 T364A probably benign Het
Shcbp1 A T 8: 4,741,876 M479K probably damaging Het
Shcbp1 A C 8: 4,754,310 F200C probably damaging Het
Slc9a3r1 C T 11: 115,163,767 A81V possibly damaging Het
Slx1b G T 7: 126,692,527 R122S probably damaging Het
Spidr A G 16: 16,114,825 probably null Het
St18 G A 1: 6,802,559 D173N probably benign Het
Stambpl1 T C 19: 34,226,648 I46T probably damaging Het
Syne1 C T 10: 5,057,886 D113N probably damaging Het
Tg G A 15: 66,725,272 V1741I probably benign Het
Thsd7b T A 1: 130,195,275 W1544R probably benign Het
Tiam2 G A 17: 3,503,008 R1120H possibly damaging Het
Tinag A T 9: 77,001,649 C337S probably damaging Het
Tm4sf1 G C 3: 57,293,089 A64G probably damaging Het
Tmprss6 A G 15: 78,443,817 Y572H unknown Het
Tnfrsf11a G A 1: 105,827,129 A309T possibly damaging Het
Txndc11 A G 16: 11,128,561 Y129H probably damaging Het
Ube3b T C 5: 114,415,681 F974S possibly damaging Het
Utrn C A 10: 12,728,009 probably null Het
Vmn1r58 T A 7: 5,411,067 M55L probably benign Het
Vnn1 T A 10: 23,900,760 S336R probably benign Het
Wwc2 T C 8: 47,869,794 Y424C unknown Het
Zfp507 T C 7: 35,776,080 I903V probably damaging Het
Zfp551 C T 7: 12,416,754 G243R probably damaging Het
Zfp60 T A 7: 27,749,019 C371S probably damaging Het
Other mutations in Fermt3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01160:Fermt3 APN 19 7003258 unclassified probably null
IGL01724:Fermt3 APN 19 7001775 missense probably damaging 0.99
IGL01748:Fermt3 APN 19 7003466 critical splice donor site probably null
IGL02392:Fermt3 APN 19 7018815 missense probably benign 0.35
IGL02956:Fermt3 APN 19 7002344 missense probably benign 0.40
IGL03146:Fermt3 APN 19 7003263 missense possibly damaging 0.88
IGL03216:Fermt3 APN 19 6999380 missense probably benign 0.00
P0026:Fermt3 UTSW 19 7014424 missense probably damaging 0.99
R0180:Fermt3 UTSW 19 7002343 missense possibly damaging 0.76
R0445:Fermt3 UTSW 19 7003299 missense probably benign 0.29
R1202:Fermt3 UTSW 19 7003482 missense probably damaging 1.00
R1475:Fermt3 UTSW 19 7018874 intron probably null
R1668:Fermt3 UTSW 19 7018692 missense probably damaging 1.00
R2179:Fermt3 UTSW 19 7014414 missense probably benign 0.14
R2311:Fermt3 UTSW 19 7014162 missense probably damaging 0.97
R3976:Fermt3 UTSW 19 7002424 missense possibly damaging 0.74
R4087:Fermt3 UTSW 19 7003577 critical splice acceptor site probably null
R4667:Fermt3 UTSW 19 7002920 missense probably damaging 1.00
R6108:Fermt3 UTSW 19 7014414 missense probably benign 0.14
R6452:Fermt3 UTSW 19 7014737 missense probably benign 0.00
R6994:Fermt3 UTSW 19 6999727 missense probably damaging 1.00
R7357:Fermt3 UTSW 19 7002843 missense probably benign
Z1177:Fermt3 UTSW 19 7014679 missense not run
Predicted Primers PCR Primer
(F):5'- TCATCTTGGCTCTTATAGTAGGAC -3'
(R):5'- AACAAACTGACCCTGAGCGG -3'

Sequencing Primer
(F):5'- GACAGTGTGGTGTCCTTAAATACCAC -3'
(R):5'- ACTGGATGACCTGGATGCAGC -3'
Posted On2019-09-13