Mutagenetix > Incidental Mutation

Incidental Mutation 'R7335:Kdm5b'

569408

Institutional Source

Beutler Lab

Gene Symbol

Kdm5b

Ensembl Gene

ENSMUSG00000042207

Gene Name

lysine (K)-specific demethylase 5B

Synonyms

Jarid1b, Plu1, Rb-Bp2, 2210016I17Rik, 2010009J12Rik, PLU-1, D1Ertd202e

MMRRC Submission

045372-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.268) question?

Stock #

R7335 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

134560171-134635285 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 134560439 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 34 (V34A)

Ref Sequence

ENSEMBL: ENSMUSP00000038138 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047714] [ENSMUST00000112198]

AlphaFold

Q80Y84

Predicted Effect

probably damaging
Transcript: ENSMUST00000047714
AA Change: V34A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000038138
Gene: ENSMUSG00000042207
AA Change: V34A

Domain	Start	End	E-Value	Type
low complexity region	7	30	N/A	INTRINSIC
JmjN	31	72	2.87e-20	SMART
ARID	94	183	7.39e-32	SMART
BRIGHT	98	188	1.51e-35	SMART
low complexity region	228	239	N/A	INTRINSIC
PHD	311	357	6.15e-14	SMART
JmjC	453	619	2.33e-67	SMART
Pfam:zf-C5HC2	692	744	2.2e-17	PFAM
Pfam:PLU-1	757	1088	5.6e-92	PFAM
low complexity region	1097	1109	N/A	INTRINSIC
PHD	1178	1222	6.2e-10	SMART
low complexity region	1225	1236	N/A	INTRINSIC
low complexity region	1406	1417	N/A	INTRINSIC
low complexity region	1470	1484	N/A	INTRINSIC
PHD	1486	1536	1.18e-6	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000112198
AA Change: V34A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000107817
Gene: ENSMUSG00000042207
AA Change: V34A

Domain	Start	End	E-Value	Type
low complexity region	7	30	N/A	INTRINSIC
JmjN	31	72	2.87e-20	SMART
ARID	94	183	7.39e-32	SMART
BRIGHT	98	188	1.51e-35	SMART
low complexity region	228	239	N/A	INTRINSIC
PHD	311	357	6.15e-14	SMART
JmjC	453	619	2.33e-67	SMART
Pfam:zf-C5HC2	692	745	6.7e-21	PFAM
Pfam:PLU-1	756	1088	6e-94	PFAM
low complexity region	1097	1109	N/A	INTRINSIC
PHD	1178	1222	6.2e-10	SMART
low complexity region	1225	1236	N/A	INTRINSIC
low complexity region	1406	1417	N/A	INTRINSIC
low complexity region	1470	1484	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (56/56)

MGI Phenotype

FUNCTION: This gene encodes a lysine-specific histone demethylase that belongs to the jumonji/ARID domain-containing family of histone demethylases. The encoded protein is capable of demethylating tri-, di- and monomethylated lysine 4 of histone H3. This protein plays a role in the transcriptional repression or certain tumor suppressor genes and is upregulated in certain cancer cells. This protein may also play a role in genome stability and DNA repair. Homozygous mutant mice display decreased body weight, decreased female fertility, lower uterine weight, and a delay in mammary development. Knockout of this gene has also been associated with embryonic lethality. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit decreased body weight, background-sensitive premature mortality, decreased female fertility, delayed mammary gland development, decreased serum estradiol levels, and reduced mammary epithelial cell proliferation in early puberty. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts2	A	G	11: 50,602,266	S35G	probably benign	Het
Adcy6	G	T	15: 98,603,876	Q286K	probably benign	Het
Agrn	A	G	4: 156,176,532	S676P	probably damaging	Het
Arntl2	A	G	6: 146,809,719	M74V	probably benign	Het
Arpp21	A	T	9: 112,176,251		probably null	Het
C1rb	A	T	6: 124,575,279	I319F	possibly damaging	Het
C2cd3	T	C	7: 100,422,603	V629A		Het
Cacna1i	T	G	15: 80,375,575	F1287C	probably damaging	Het
Catspere2	A	G	1: 178,098,508	I247V	probably benign	Het
Cd101	C	G	3: 101,018,729	A229P	probably benign	Het
Cdh23	T	C	10: 60,305,116	D3151G	probably damaging	Het
Cenpc1	C	A	5: 86,034,353	K557N	possibly damaging	Het
Col6a4	G	A	9: 106,076,892	T416M	possibly damaging	Het
Cyp2c67	A	T	19: 39,640,007	C164*	probably null	Het
Dopey2	A	G	16: 93,747,508	E179G	probably benign	Het
Duoxa2	A	T	2: 122,301,340	Y170F	possibly damaging	Het
Fras1	A	G	5: 96,736,970	K2569R	possibly damaging	Het
Fsip2	C	A	2: 82,983,118	H3260Q	probably benign	Het
Gm3402	T	C	5: 146,515,233	I121T	probably benign	Het
Herc3	T	A	6: 58,876,788	H606Q	possibly damaging	Het
Hmcn2	T	C	2: 31,392,157	V1927A	possibly damaging	Het
Hnf4g	A	G	3: 3,652,864	H347R	possibly damaging	Het
Hs3st3a1	A	G	11: 64,520,337	T234A	probably benign	Het
Hyal1	G	T	9: 107,579,160	V379L	probably benign	Het
Ighv1-19	A	G	12: 114,708,951		probably benign	Het
Iqcc	T	A	4: 129,616,708	Q338L	not run	Het
Lgals4	T	C	7: 28,841,146	F225L	probably benign	Het
Lmtk3	C	T	7: 45,795,157	T1088I	unknown	Het
Magel2	A	T	7: 62,380,776	S1143C	unknown	Het
Mapk4	A	T	18: 73,937,267	L185Q	possibly damaging	Het
Ncam1	A	G	9: 49,506,911	S1030P		Het
Nynrin	A	T	14: 55,863,914	T347S	probably benign	Het
Pak7	T	C	2: 136,098,299	T532A	probably damaging	Het
Pcdhb15	A	G	18: 37,474,336	E207G	probably damaging	Het
Pde6h	T	C	6: 136,963,213	W66R	probably damaging	Het
Pmaip1	T	C	18: 66,458,814		probably null	Het
Prkd3	A	G	17: 78,954,566	F774S	probably damaging	Het
Prox1	T	A	1: 190,161,845	R134S	possibly damaging	Het
Ptpn22	T	A	3: 103,886,019	H495Q	probably damaging	Het
Ptprj	G	T	2: 90,440,782	Q1201K	probably benign	Het
Rp1l1	A	G	14: 64,031,998	S1678G	probably benign	Het
Sez6l	G	T	5: 112,576,812		probably null	Het
Sgcg	T	A	14: 61,240,367	Y91F	probably damaging	Het
Skint2	C	T	4: 112,624,218	L93F	probably damaging	Het
Slc22a22	A	T	15: 57,263,375	D99E	probably benign	Het
Slco3a1	A	G	7: 74,284,342	I694T	probably damaging	Het
Smurf2	A	T	11: 106,846,085	I305N	possibly damaging	Het
Soga1	T	C	2: 157,031,005	Q862R	possibly damaging	Het
Stac3	T	A	10: 127,504,900	V178D	probably benign	Het
Suclg2	T	A	6: 95,566,460	N330I	probably damaging	Het
Suclg2	G	A	6: 95,566,463	A329V	probably damaging	Het
Tas2r118	C	T	6: 23,969,750	C104Y	probably damaging	Het
Tom1l2	T	G	11: 60,245,165	E327D	probably benign	Het
Trit1	T	C	4: 123,016,779	M57T	possibly damaging	Het
Vav1	G	A	17: 57,296,720	S134N	probably benign	Het
Vmn2r82	T	C	10: 79,378,888	L235P	probably damaging	Het
Zfp735	T	A	11: 73,711,553	V441E	possibly damaging	Het

Other mutations in Kdm5b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00230:Kdm5b	APN	1	134620955	missense	probably damaging	1.00
IGL01458:Kdm5b	APN	1	134621986	missense	possibly damaging	0.53
IGL01567:Kdm5b	APN	1	134602540	missense	probably damaging	1.00
IGL01625:Kdm5b	APN	1	134617968	missense	possibly damaging	0.74
IGL01970:Kdm5b	APN	1	134600727	missense	probably damaging	1.00
IGL02183:Kdm5b	APN	1	134624931	missense	probably benign	0.09
IGL02592:Kdm5b	APN	1	134624853	missense	probably damaging	0.99
IGL02695:Kdm5b	APN	1	134604485	missense	possibly damaging	0.94
IGL02697:Kdm5b	APN	1	134588773	splice site	probably benign
IGL03036:Kdm5b	APN	1	134608937	missense	probably damaging	1.00
IGL03056:Kdm5b	APN	1	134587979	missense	probably damaging	0.99
IGL03206:Kdm5b	APN	1	134627317	missense	probably benign
IGL03342:Kdm5b	APN	1	134602576	missense	probably benign	0.00
IGL03388:Kdm5b	APN	1	134627322	missense	probably benign
amaryllis	UTSW	1	134609061	critical splice donor site	probably null
PIT4486001:Kdm5b	UTSW	1	134628685	missense	probably damaging	1.00
R0233:Kdm5b	UTSW	1	134604634	splice site	probably benign
R0334:Kdm5b	UTSW	1	134604522	missense	probably damaging	0.99
R0504:Kdm5b	UTSW	1	134621023	critical splice donor site	probably null
R0505:Kdm5b	UTSW	1	134602571	missense	probably damaging	0.96
R0521:Kdm5b	UTSW	1	134618033	missense	possibly damaging	0.65
R1004:Kdm5b	UTSW	1	134588904	missense	possibly damaging	0.71
R1087:Kdm5b	UTSW	1	134600637	missense	probably damaging	1.00
R1126:Kdm5b	UTSW	1	134613991	missense	possibly damaging	0.90
R1221:Kdm5b	UTSW	1	134599091	missense	probably damaging	0.98
R1230:Kdm5b	UTSW	1	134613254	missense	probably damaging	1.00
R1345:Kdm5b	UTSW	1	134630550	missense	possibly damaging	0.94
R1482:Kdm5b	UTSW	1	134624897	missense	probably damaging	1.00
R1582:Kdm5b	UTSW	1	134624853	missense	probably damaging	0.99
R1653:Kdm5b	UTSW	1	134602481	missense	probably damaging	1.00
R1693:Kdm5b	UTSW	1	134597576	splice site	probably benign
R1721:Kdm5b	UTSW	1	134613181	splice site	probably benign
R1741:Kdm5b	UTSW	1	134618017	missense	possibly damaging	0.82
R1762:Kdm5b	UTSW	1	134604467	nonsense	probably null
R1820:Kdm5b	UTSW	1	134597670	missense	possibly damaging	0.87
R1872:Kdm5b	UTSW	1	134624994	missense	probably damaging	1.00
R1966:Kdm5b	UTSW	1	134613873	splice site	probably null
R2056:Kdm5b	UTSW	1	134613214	missense	probably benign	0.05
R2059:Kdm5b	UTSW	1	134613214	missense	probably benign	0.05
R2405:Kdm5b	UTSW	1	134609016	missense	probably damaging	0.97
R3417:Kdm5b	UTSW	1	134587977	missense	probably damaging	1.00
R3771:Kdm5b	UTSW	1	134613345	missense	probably damaging	1.00
R3783:Kdm5b	UTSW	1	134630542	missense	probably benign
R3803:Kdm5b	UTSW	1	134615941	missense	probably benign	0.07
R3980:Kdm5b	UTSW	1	134619670	missense	probably benign	0.11
R3983:Kdm5b	UTSW	1	134631304	missense	possibly damaging	0.91
R4013:Kdm5b	UTSW	1	134627329	missense	possibly damaging	0.86
R4162:Kdm5b	UTSW	1	134625161	missense	probably benign	0.01
R4701:Kdm5b	UTSW	1	134606012	intron	probably benign
R4791:Kdm5b	UTSW	1	134630800	missense	possibly damaging	0.82
R4836:Kdm5b	UTSW	1	134593315	splice site	probably null
R4924:Kdm5b	UTSW	1	134631351	missense	probably benign	0.00
R5135:Kdm5b	UTSW	1	134588746	intron	probably benign
R5248:Kdm5b	UTSW	1	134620997	missense	probably benign	0.11
R5290:Kdm5b	UTSW	1	134622099	splice site	probably null
R5358:Kdm5b	UTSW	1	134607694	nonsense	probably null
R5388:Kdm5b	UTSW	1	134608897	nonsense	probably null
R5396:Kdm5b	UTSW	1	134622098	splice site	probably null
R5397:Kdm5b	UTSW	1	134622098	splice site	probably null
R5398:Kdm5b	UTSW	1	134622098	splice site	probably null
R5399:Kdm5b	UTSW	1	134622098	splice site	probably null
R5529:Kdm5b	UTSW	1	134588003	missense	probably damaging	1.00
R5540:Kdm5b	UTSW	1	134631241	missense	probably damaging	0.98
R5661:Kdm5b	UTSW	1	134599073	missense	probably benign	0.01
R5663:Kdm5b	UTSW	1	134630635	missense	probably benign
R5822:Kdm5b	UTSW	1	134588773	splice site	probably benign
R6226:Kdm5b	UTSW	1	134608878	missense	probably damaging	0.99
R6368:Kdm5b	UTSW	1	134599207	missense	probably damaging	1.00
R6681:Kdm5b	UTSW	1	134613269	missense	possibly damaging	0.90
R6715:Kdm5b	UTSW	1	134609061	critical splice donor site	probably null
R7132:Kdm5b	UTSW	1	134599106	missense	probably damaging	1.00
R7202:Kdm5b	UTSW	1	134624759	missense	probably benign
R7258:Kdm5b	UTSW	1	134621021	missense	probably damaging	1.00
R7420:Kdm5b	UTSW	1	134604497	missense	probably benign	0.14
R7426:Kdm5b	UTSW	1	134595833	missense	probably benign	0.02
R7452:Kdm5b	UTSW	1	134624948	missense	probably damaging	1.00
R7595:Kdm5b	UTSW	1	134608966	missense	probably benign	0.00
R7612:Kdm5b	UTSW	1	134624918	nonsense	probably null
R7704:Kdm5b	UTSW	1	134587931	missense	probably damaging	1.00
R7846:Kdm5b	UTSW	1	134617840	missense	probably damaging	1.00
R8115:Kdm5b	UTSW	1	134619673	missense	possibly damaging	0.83
R8146:Kdm5b	UTSW	1	134625126	missense	probably benign	0.05
R8160:Kdm5b	UTSW	1	134613919	missense	probably damaging	1.00
R8527:Kdm5b	UTSW	1	134605774	missense	possibly damaging	0.78
R8542:Kdm5b	UTSW	1	134605774	missense	possibly damaging	0.78
R8930:Kdm5b	UTSW	1	134616272	missense	probably damaging	1.00
R8932:Kdm5b	UTSW	1	134616272	missense	probably damaging	1.00
R8950:Kdm5b	UTSW	1	134613926	missense	possibly damaging	0.84
R9089:Kdm5b	UTSW	1	134607768	missense	probably damaging	0.98
R9109:Kdm5b	UTSW	1	134600755	critical splice donor site	probably null
R9133:Kdm5b	UTSW	1	134602585	missense	probably benign
R9298:Kdm5b	UTSW	1	134600755	critical splice donor site	probably null
R9423:Kdm5b	UTSW	1	134587967	missense	possibly damaging	0.85
R9630:Kdm5b	UTSW	1	134585233	critical splice donor site	probably null
R9670:Kdm5b	UTSW	1	134630502	nonsense	probably null
X0063:Kdm5b	UTSW	1	134588876	missense	probably benign	0.07
Z1176:Kdm5b	UTSW	1	134625035	missense	probably damaging	1.00
Z1177:Kdm5b	UTSW	1	134595798	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- TAGAAGTCGGACCTGTCGCC -3'
(R):5'- TGAAAACTTTCCTCCTCACACG -3'

Sequencing Primer
(F):5'- TCTGCACGGGTTTCGGAC -3'
(R):5'- CCCAAACTTGACCGGGC -3'

Posted On

2019-09-13