Incidental Mutation 'R7335:Hnf4g'
ID569417
Institutional Source Beutler Lab
Gene Symbol Hnf4g
Ensembl Gene ENSMUSG00000017688
Gene Namehepatocyte nuclear factor 4, gamma
SynonymsNR2A2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.236) question?
Stock #R7335 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location3508030-3658052 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 3652864 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 347 (H347R)
Ref Sequence ENSEMBL: ENSMUSP00000104030 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108393] [ENSMUST00000108394]
Predicted Effect possibly damaging
Transcript: ENSMUST00000108393
AA Change: H347R

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000104030
Gene: ENSMUSG00000017688
AA Change: H347R

DomainStartEndE-ValueType
ZnF_C4 9 80 6.51e-35 SMART
low complexity region 118 125 N/A INTRINSIC
HOLI 141 299 7.29e-47 SMART
low complexity region 334 345 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108394
AA Change: H391R

PolyPhen 2 Score 0.638 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000104031
Gene: ENSMUSG00000017688
AA Change: H391R

DomainStartEndE-ValueType
ZnF_C4 63 134 6.51e-35 SMART
low complexity region 172 179 N/A INTRINSIC
HOLI 195 353 7.29e-47 SMART
low complexity region 388 399 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (56/56)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele are less inclined to build nests, spend more time in a passive state during the forced swim test, and display a reduction in energy expenditure and night time activity that results in increased body weight despite adecreased intake of food and water. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts2 A G 11: 50,602,266 S35G probably benign Het
Adcy6 G T 15: 98,603,876 Q286K probably benign Het
Agrn A G 4: 156,176,532 S676P probably damaging Het
Arntl2 A G 6: 146,809,719 M74V probably benign Het
Arpp21 A T 9: 112,176,251 probably null Het
C1rb A T 6: 124,575,279 I319F possibly damaging Het
C2cd3 T C 7: 100,422,603 V629A Het
Cacna1i T G 15: 80,375,575 F1287C probably damaging Het
Catspere2 A G 1: 178,098,508 I247V probably benign Het
Cd101 C G 3: 101,018,729 A229P probably benign Het
Cdh23 T C 10: 60,305,116 D3151G probably damaging Het
Cenpc1 C A 5: 86,034,353 K557N possibly damaging Het
Col6a4 G A 9: 106,076,892 T416M possibly damaging Het
Cyp2c67 A T 19: 39,640,007 C164* probably null Het
Dopey2 A G 16: 93,747,508 E179G probably benign Het
Duoxa2 A T 2: 122,301,340 Y170F possibly damaging Het
Fras1 A G 5: 96,736,970 K2569R possibly damaging Het
Fsip2 C A 2: 82,983,118 H3260Q probably benign Het
Gm3402 T C 5: 146,515,233 I121T probably benign Het
Herc3 T A 6: 58,876,788 H606Q possibly damaging Het
Hmcn2 T C 2: 31,392,157 V1927A possibly damaging Het
Hs3st3a1 A G 11: 64,520,337 T234A probably benign Het
Hyal1 G T 9: 107,579,160 V379L probably benign Het
Ighv1-19 A G 12: 114,708,951 probably benign Het
Iqcc T A 4: 129,616,708 Q338L not run Het
Kdm5b T C 1: 134,560,439 V34A probably damaging Het
Lgals4 T C 7: 28,841,146 F225L probably benign Het
Lmtk3 C T 7: 45,795,157 T1088I unknown Het
Magel2 A T 7: 62,380,776 S1143C unknown Het
Mapk4 A T 18: 73,937,267 L185Q possibly damaging Het
Ncam1 A G 9: 49,506,911 S1030P Het
Nynrin A T 14: 55,863,914 T347S probably benign Het
Pak7 T C 2: 136,098,299 T532A probably damaging Het
Pcdhb15 A G 18: 37,474,336 E207G probably damaging Het
Pde6h T C 6: 136,963,213 W66R probably damaging Het
Pmaip1 T C 18: 66,458,814 probably null Het
Prkd3 A G 17: 78,954,566 F774S probably damaging Het
Prox1 T A 1: 190,161,845 R134S possibly damaging Het
Ptpn22 T A 3: 103,886,019 H495Q probably damaging Het
Ptprj G T 2: 90,440,782 Q1201K probably benign Het
Rp1l1 A G 14: 64,031,998 S1678G probably benign Het
Sez6l G T 5: 112,576,812 probably null Het
Sgcg T A 14: 61,240,367 Y91F probably damaging Het
Skint2 C T 4: 112,624,218 L93F probably damaging Het
Slc22a22 A T 15: 57,263,375 D99E probably benign Het
Slco3a1 A G 7: 74,284,342 I694T probably damaging Het
Smurf2 A T 11: 106,846,085 I305N possibly damaging Het
Soga1 T C 2: 157,031,005 Q862R possibly damaging Het
Stac3 T A 10: 127,504,900 V178D probably benign Het
Suclg2 T A 6: 95,566,460 N330I probably damaging Het
Suclg2 G A 6: 95,566,463 A329V probably damaging Het
Tas2r118 C T 6: 23,969,750 C104Y probably damaging Het
Tom1l2 T G 11: 60,245,165 E327D probably benign Het
Trit1 T C 4: 123,016,779 M57T possibly damaging Het
Vav1 G A 17: 57,296,720 S134N probably benign Het
Vmn2r82 T C 10: 79,378,888 L235P probably damaging Het
Zfp735 T A 11: 73,711,553 V441E possibly damaging Het
Other mutations in Hnf4g
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Hnf4g APN 3 3648082 missense probably benign
IGL00832:Hnf4g APN 3 3641276 missense probably damaging 1.00
IGL01571:Hnf4g APN 3 3651266 splice site probably benign
IGL01896:Hnf4g APN 3 3651410 missense probably damaging 1.00
IGL02068:Hnf4g APN 3 3644576 missense probably benign
IGL03040:Hnf4g APN 3 3634211 utr 5 prime probably benign
IGL03097:Hnf4g UTSW 3 3651614 missense probably damaging 1.00
R0124:Hnf4g UTSW 3 3643082 splice site probably benign
R0477:Hnf4g UTSW 3 3651791 splice site probably benign
R0512:Hnf4g UTSW 3 3651622 missense probably damaging 1.00
R0744:Hnf4g UTSW 3 3651629 missense possibly damaging 0.92
R1323:Hnf4g UTSW 3 3634221 missense possibly damaging 0.73
R1323:Hnf4g UTSW 3 3634221 missense possibly damaging 0.73
R1656:Hnf4g UTSW 3 3652951 missense probably benign
R1982:Hnf4g UTSW 3 3638208 missense probably damaging 0.99
R2336:Hnf4g UTSW 3 3641224 missense probably benign 0.25
R3104:Hnf4g UTSW 3 3652856 missense probably benign 0.42
R3105:Hnf4g UTSW 3 3652856 missense probably benign 0.42
R3106:Hnf4g UTSW 3 3652856 missense probably benign 0.42
R3843:Hnf4g UTSW 3 3651302 missense probably benign 0.09
R4200:Hnf4g UTSW 3 3651284 missense possibly damaging 0.94
R4248:Hnf4g UTSW 3 3652849 missense possibly damaging 0.69
R4418:Hnf4g UTSW 3 3648094 missense possibly damaging 0.66
R4756:Hnf4g UTSW 3 3643009 missense possibly damaging 0.69
R4871:Hnf4g UTSW 3 3651388 missense possibly damaging 0.94
R5022:Hnf4g UTSW 3 3644587 missense probably damaging 0.99
R5023:Hnf4g UTSW 3 3644587 missense probably damaging 0.99
R5088:Hnf4g UTSW 3 3657121 missense probably benign 0.09
R5604:Hnf4g UTSW 3 3657126 nonsense probably null
R6746:Hnf4g UTSW 3 3657110 nonsense probably null
R7088:Hnf4g UTSW 3 3648125 splice site probably null
Predicted Primers PCR Primer
(F):5'- ACATGAAAGTAGTTCTCCCCATTTG -3'
(R):5'- GCACAGCTAACTAGAGGAAATTCTATC -3'

Sequencing Primer
(F):5'- GAAAGTAGTTCTCCCCATTTGTTTTC -3'
(R):5'- GTATGAACCAGTGTGGAC -3'
Posted On2019-09-13