Incidental Mutation 'R7335:Cenpc1'
ID569424
Institutional Source Beutler Lab
Gene Symbol Cenpc1
Ensembl Gene ENSMUSG00000029253
Gene Namecentromere protein C1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7335 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location86012024-86065583 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 86034353 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 557 (K557N)
Ref Sequence ENSEMBL: ENSMUSP00000031170 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031170]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031170
AA Change: K557N

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000031170
Gene: ENSMUSG00000029253
AA Change: K557N

DomainStartEndE-ValueType
Pfam:CENP_C_N 7 121 6.1e-42 PFAM
Pfam:CENP_C_N 115 261 2.6e-46 PFAM
Pfam:CENP-C_mid 265 519 5.4e-100 PFAM
PDB:4INM|W 700 724 5e-9 PDB
Pfam:CENP-C_C 819 903 3.9e-28 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: This gene encodes a centromeric protein component of a nucleosome-associated complex that plays a central role in kinetochore protein assembly, mitotic progression and chromosome segregation. The human ortholog encodes a protein with DNA-binding activity, that associates constitutively to kinetochores throughout the cell cycle, as part of a prekinetochore complex, together with centromeric protein-A and centromeric protein-B. Multiple pseudogenes of this gene have been identified. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]
PHENOTYPE: Homozygous mutation of this gene results in early embryonic lethality and mitotic abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts2 A G 11: 50,602,266 S35G probably benign Het
Adcy6 G T 15: 98,603,876 Q286K probably benign Het
Agrn A G 4: 156,176,532 S676P probably damaging Het
Arntl2 A G 6: 146,809,719 M74V probably benign Het
Arpp21 A T 9: 112,176,251 probably null Het
C1rb A T 6: 124,575,279 I319F possibly damaging Het
C2cd3 T C 7: 100,422,603 V629A Het
Cacna1i T G 15: 80,375,575 F1287C probably damaging Het
Catspere2 A G 1: 178,098,508 I247V probably benign Het
Cd101 C G 3: 101,018,729 A229P probably benign Het
Cdh23 T C 10: 60,305,116 D3151G probably damaging Het
Col6a4 G A 9: 106,076,892 T416M possibly damaging Het
Cyp2c67 A T 19: 39,640,007 C164* probably null Het
Dopey2 A G 16: 93,747,508 E179G probably benign Het
Duoxa2 A T 2: 122,301,340 Y170F possibly damaging Het
Fras1 A G 5: 96,736,970 K2569R possibly damaging Het
Fsip2 C A 2: 82,983,118 H3260Q probably benign Het
Gm3402 T C 5: 146,515,233 I121T probably benign Het
Herc3 T A 6: 58,876,788 H606Q possibly damaging Het
Hmcn2 T C 2: 31,392,157 V1927A possibly damaging Het
Hnf4g A G 3: 3,652,864 H347R possibly damaging Het
Hs3st3a1 A G 11: 64,520,337 T234A probably benign Het
Hyal1 G T 9: 107,579,160 V379L probably benign Het
Ighv1-19 A G 12: 114,708,951 probably benign Het
Iqcc T A 4: 129,616,708 Q338L not run Het
Kdm5b T C 1: 134,560,439 V34A probably damaging Het
Lgals4 T C 7: 28,841,146 F225L probably benign Het
Lmtk3 C T 7: 45,795,157 T1088I unknown Het
Magel2 A T 7: 62,380,776 S1143C unknown Het
Mapk4 A T 18: 73,937,267 L185Q possibly damaging Het
Ncam1 A G 9: 49,506,911 S1030P Het
Nynrin A T 14: 55,863,914 T347S probably benign Het
Pak7 T C 2: 136,098,299 T532A probably damaging Het
Pcdhb15 A G 18: 37,474,336 E207G probably damaging Het
Pde6h T C 6: 136,963,213 W66R probably damaging Het
Pmaip1 T C 18: 66,458,814 probably null Het
Prkd3 A G 17: 78,954,566 F774S probably damaging Het
Prox1 T A 1: 190,161,845 R134S possibly damaging Het
Ptpn22 T A 3: 103,886,019 H495Q probably damaging Het
Ptprj G T 2: 90,440,782 Q1201K probably benign Het
Rp1l1 A G 14: 64,031,998 S1678G probably benign Het
Sez6l G T 5: 112,576,812 probably null Het
Sgcg T A 14: 61,240,367 Y91F probably damaging Het
Skint2 C T 4: 112,624,218 L93F probably damaging Het
Slc22a22 A T 15: 57,263,375 D99E probably benign Het
Slco3a1 A G 7: 74,284,342 I694T probably damaging Het
Smurf2 A T 11: 106,846,085 I305N possibly damaging Het
Soga1 T C 2: 157,031,005 Q862R possibly damaging Het
Stac3 T A 10: 127,504,900 V178D probably benign Het
Suclg2 T A 6: 95,566,460 N330I probably damaging Het
Suclg2 G A 6: 95,566,463 A329V probably damaging Het
Tas2r118 C T 6: 23,969,750 C104Y probably damaging Het
Tom1l2 T G 11: 60,245,165 E327D probably benign Het
Trit1 T C 4: 123,016,779 M57T possibly damaging Het
Vav1 G A 17: 57,296,720 S134N probably benign Het
Vmn2r82 T C 10: 79,378,888 L235P probably damaging Het
Zfp735 T A 11: 73,711,553 V441E possibly damaging Het
Other mutations in Cenpc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00921:Cenpc1 APN 5 86037528 missense probably benign 0.02
IGL01287:Cenpc1 APN 5 86022454 nonsense probably null
IGL01363:Cenpc1 APN 5 86046531 nonsense probably null
IGL01720:Cenpc1 APN 5 86045425 missense possibly damaging 0.84
IGL02217:Cenpc1 APN 5 86029200 splice site probably benign
IGL02665:Cenpc1 APN 5 86046403 missense probably benign 0.01
IGL03022:Cenpc1 APN 5 86022375 splice site probably benign
IGL03162:Cenpc1 APN 5 86037905 missense possibly damaging 0.94
IGL03343:Cenpc1 APN 5 86016322 missense probably damaging 0.96
R0130:Cenpc1 UTSW 5 86046546 missense probably benign 0.07
R0193:Cenpc1 UTSW 5 86032403 missense probably benign 0.30
R0314:Cenpc1 UTSW 5 86037371 missense probably benign 0.20
R0932:Cenpc1 UTSW 5 86037600 missense possibly damaging 0.94
R0973:Cenpc1 UTSW 5 86037908 missense probably damaging 1.00
R0973:Cenpc1 UTSW 5 86037908 missense probably damaging 1.00
R0974:Cenpc1 UTSW 5 86037908 missense probably damaging 1.00
R1240:Cenpc1 UTSW 5 86035510 missense probably benign 0.32
R1454:Cenpc1 UTSW 5 86013510 missense possibly damaging 0.71
R1677:Cenpc1 UTSW 5 86061998 splice site probably benign
R2044:Cenpc1 UTSW 5 86037755 missense probably benign 0.01
R2256:Cenpc1 UTSW 5 86016203 missense probably damaging 1.00
R3085:Cenpc1 UTSW 5 86037617 missense probably benign 0.01
R4516:Cenpc1 UTSW 5 86047587 missense possibly damaging 0.72
R4518:Cenpc1 UTSW 5 86047587 missense possibly damaging 0.72
R4561:Cenpc1 UTSW 5 86047632 missense probably damaging 1.00
R4827:Cenpc1 UTSW 5 86034431 missense possibly damaging 0.67
R4864:Cenpc1 UTSW 5 86045321 missense probably damaging 1.00
R5222:Cenpc1 UTSW 5 86037747 missense possibly damaging 0.77
R5707:Cenpc1 UTSW 5 86035434 missense possibly damaging 0.82
R5920:Cenpc1 UTSW 5 86020910 missense probably benign 0.00
R5999:Cenpc1 UTSW 5 86012263 missense probably damaging 1.00
R6073:Cenpc1 UTSW 5 86058153 critical splice donor site probably null
R6209:Cenpc1 UTSW 5 86033650 missense probably benign 0.02
R6244:Cenpc1 UTSW 5 86046385 missense probably damaging 1.00
R6278:Cenpc1 UTSW 5 86035535 missense probably damaging 0.97
R6395:Cenpc1 UTSW 5 86035570 missense probably benign 0.14
R7269:Cenpc1 UTSW 5 86013507 missense probably damaging 1.00
R7269:Cenpc1 UTSW 5 86032418 missense probably benign 0.12
R7378:Cenpc1 UTSW 5 86046499 missense probably benign 0.02
R7968:Cenpc1 UTSW 5 86033692 missense probably benign
R8380:Cenpc1 UTSW 5 86046416 missense probably benign 0.00
RF018:Cenpc1 UTSW 5 86045369 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- GCCAAACCAGCAAATTCTGAATGAG -3'
(R):5'- GGTGTCAGTATTCAGTGAGCC -3'

Sequencing Primer
(F):5'- CCAGCAAATTCTGAATGAGAAAAAG -3'
(R):5'- GTCAGTATTCAGTGAGCCAGATC -3'
Posted On2019-09-13