Incidental Mutation 'R7335:Tas2r118'
ID569427
Institutional Source Beutler Lab
Gene Symbol Tas2r118
Ensembl Gene ENSMUSG00000043865
Gene Nametaste receptor, type 2, member 118
SynonymsmGR18, mt2r40, T2R18, Tas2r18
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R7335 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location23969161-23970060 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 23969750 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 104 (C104Y)
Ref Sequence ENSEMBL: ENSMUSP00000053700 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062463]
Predicted Effect probably damaging
Transcript: ENSMUST00000062463
AA Change: C104Y

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000053700
Gene: ENSMUSG00000043865
AA Change: C104Y

DomainStartEndE-ValueType
Pfam:TAS2R 1 297 4.6e-87 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of candidate taste receptors that are members of the G protein-coupled receptor superfamily. These family members are specifically expressed by taste receptor cells of the tongue and palate epithelia. Each of these apparently intronless genes encodes a 7-transmembrane receptor protein, functioning as a bitter taste receptor. This gene is clustered with another 3 candidate taste receptor genes in chromosome 7 and is genetically linked to loci that influence bitter perception. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts2 A G 11: 50,602,266 S35G probably benign Het
Adcy6 G T 15: 98,603,876 Q286K probably benign Het
Agrn A G 4: 156,176,532 S676P probably damaging Het
Arntl2 A G 6: 146,809,719 M74V probably benign Het
Arpp21 A T 9: 112,176,251 probably null Het
C1rb A T 6: 124,575,279 I319F possibly damaging Het
C2cd3 T C 7: 100,422,603 V629A Het
Cacna1i T G 15: 80,375,575 F1287C probably damaging Het
Catspere2 A G 1: 178,098,508 I247V probably benign Het
Cd101 C G 3: 101,018,729 A229P probably benign Het
Cdh23 T C 10: 60,305,116 D3151G probably damaging Het
Cenpc1 C A 5: 86,034,353 K557N possibly damaging Het
Col6a4 G A 9: 106,076,892 T416M possibly damaging Het
Cyp2c67 A T 19: 39,640,007 C164* probably null Het
Dopey2 A G 16: 93,747,508 E179G probably benign Het
Duoxa2 A T 2: 122,301,340 Y170F possibly damaging Het
Fras1 A G 5: 96,736,970 K2569R possibly damaging Het
Fsip2 C A 2: 82,983,118 H3260Q probably benign Het
Gm3402 T C 5: 146,515,233 I121T probably benign Het
Herc3 T A 6: 58,876,788 H606Q possibly damaging Het
Hmcn2 T C 2: 31,392,157 V1927A possibly damaging Het
Hnf4g A G 3: 3,652,864 H347R possibly damaging Het
Hs3st3a1 A G 11: 64,520,337 T234A probably benign Het
Hyal1 G T 9: 107,579,160 V379L probably benign Het
Ighv1-19 A G 12: 114,708,951 probably benign Het
Iqcc T A 4: 129,616,708 Q338L not run Het
Kdm5b T C 1: 134,560,439 V34A probably damaging Het
Lgals4 T C 7: 28,841,146 F225L probably benign Het
Lmtk3 C T 7: 45,795,157 T1088I unknown Het
Magel2 A T 7: 62,380,776 S1143C unknown Het
Mapk4 A T 18: 73,937,267 L185Q possibly damaging Het
Ncam1 A G 9: 49,506,911 S1030P Het
Nynrin A T 14: 55,863,914 T347S probably benign Het
Pak7 T C 2: 136,098,299 T532A probably damaging Het
Pcdhb15 A G 18: 37,474,336 E207G probably damaging Het
Pde6h T C 6: 136,963,213 W66R probably damaging Het
Pmaip1 T C 18: 66,458,814 probably null Het
Prkd3 A G 17: 78,954,566 F774S probably damaging Het
Prox1 T A 1: 190,161,845 R134S possibly damaging Het
Ptpn22 T A 3: 103,886,019 H495Q probably damaging Het
Ptprj G T 2: 90,440,782 Q1201K probably benign Het
Rp1l1 A G 14: 64,031,998 S1678G probably benign Het
Sez6l G T 5: 112,576,812 probably null Het
Sgcg T A 14: 61,240,367 Y91F probably damaging Het
Skint2 C T 4: 112,624,218 L93F probably damaging Het
Slc22a22 A T 15: 57,263,375 D99E probably benign Het
Slco3a1 A G 7: 74,284,342 I694T probably damaging Het
Smurf2 A T 11: 106,846,085 I305N possibly damaging Het
Soga1 T C 2: 157,031,005 Q862R possibly damaging Het
Stac3 T A 10: 127,504,900 V178D probably benign Het
Suclg2 T A 6: 95,566,460 N330I probably damaging Het
Suclg2 G A 6: 95,566,463 A329V probably damaging Het
Tom1l2 T G 11: 60,245,165 E327D probably benign Het
Trit1 T C 4: 123,016,779 M57T possibly damaging Het
Vav1 G A 17: 57,296,720 S134N probably benign Het
Vmn2r82 T C 10: 79,378,888 L235P probably damaging Het
Zfp735 T A 11: 73,711,553 V441E possibly damaging Het
Other mutations in Tas2r118
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01350:Tas2r118 APN 6 23969747 missense probably damaging 0.99
IGL02517:Tas2r118 APN 6 23969892 missense probably damaging 1.00
IGL03387:Tas2r118 APN 6 23969181 missense possibly damaging 0.71
PIT4382001:Tas2r118 UTSW 6 23969786 missense possibly damaging 0.61
R0241:Tas2r118 UTSW 6 23969339 missense probably damaging 1.00
R0241:Tas2r118 UTSW 6 23969339 missense probably damaging 1.00
R0544:Tas2r118 UTSW 6 23969401 missense probably damaging 0.97
R1438:Tas2r118 UTSW 6 23969423 missense possibly damaging 0.79
R1471:Tas2r118 UTSW 6 23969171 missense probably damaging 0.96
R1632:Tas2r118 UTSW 6 23969261 missense probably benign 0.21
R2096:Tas2r118 UTSW 6 23969913 missense possibly damaging 0.90
R2106:Tas2r118 UTSW 6 23969570 missense probably benign
R2903:Tas2r118 UTSW 6 23969802 missense possibly damaging 0.87
R2904:Tas2r118 UTSW 6 23969802 missense possibly damaging 0.87
R2905:Tas2r118 UTSW 6 23969802 missense possibly damaging 0.87
R3798:Tas2r118 UTSW 6 23969823 missense possibly damaging 0.71
R4402:Tas2r118 UTSW 6 23969294 missense probably benign 0.11
R4647:Tas2r118 UTSW 6 23969468 missense probably damaging 1.00
R4707:Tas2r118 UTSW 6 23969226 missense probably benign 0.26
R4965:Tas2r118 UTSW 6 23969628 missense probably benign 0.41
R5114:Tas2r118 UTSW 6 23969210 missense probably benign 0.05
R5823:Tas2r118 UTSW 6 23969471 missense probably benign 0.04
R5834:Tas2r118 UTSW 6 23969877 missense probably benign 0.06
R6976:Tas2r118 UTSW 6 23969471 missense probably benign 0.04
X0062:Tas2r118 UTSW 6 23969440 missense probably damaging 1.00
Z1177:Tas2r118 UTSW 6 23969559 missense not run
Predicted Primers PCR Primer
(F):5'- TCTTGGGTAAATTATCTAGGGTGAC -3'
(R):5'- AAGTTGCACAACGGTTGCAG -3'

Sequencing Primer
(F):5'- ATCTAGGGTGACTAATTCCATCTGG -3'
(R):5'- TTCAAAGACTGTCACCGGTG -3'
Posted On2019-09-13