Incidental Mutation 'R7335:Suclg2'
ID569430
Institutional Source Beutler Lab
Gene Symbol Suclg2
Ensembl Gene ENSMUSG00000061838
Gene Namesuccinate-Coenzyme A ligase, GDP-forming, beta subunit
SynonymsD6Wsu120e
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7335 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location95473009-95718800 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 95566463 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 329 (A329V)
Ref Sequence ENSEMBL: ENSMUSP00000144827 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079847] [ENSMUST00000204224]
Predicted Effect probably damaging
Transcript: ENSMUST00000079847
AA Change: A280V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078774
Gene: ENSMUSG00000061838
AA Change: A280V

DomainStartEndE-ValueType
low complexity region 14 27 N/A INTRINSIC
Pfam:ATP-grasp_5 33 263 1.1e-11 PFAM
Pfam:ATP-grasp_2 40 248 2.4e-79 PFAM
Pfam:Ligase_CoA 307 427 3.4e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000204224
AA Change: A329V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144827
Gene: ENSMUSG00000061838
AA Change: A329V

DomainStartEndE-ValueType
low complexity region 14 27 N/A INTRINSIC
Pfam:ATP-grasp_5 33 263 1.1e-11 PFAM
Pfam:ATP-grasp_2 40 248 2.4e-79 PFAM
Pfam:Ligase_CoA 307 427 3.4e-28 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a GTP-specific beta subunit of succinyl-CoA synthetase. Succinyl-CoA synthetase catalyzes the reversible reaction involving the formation of succinyl-CoA and succinate. Alternate splicing results in multiple transcript variants. Pseudogenes of this gene are found on chromosomes 5 and 12. [provided by RefSeq, Apr 2010]
PHENOTYPE: Homozygous knockout with a gene trap is embryonic lethal. Heterozygosity has a mild effect on mitochondrial respiration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts2 A G 11: 50,602,266 S35G probably benign Het
Adcy6 G T 15: 98,603,876 Q286K probably benign Het
Agrn A G 4: 156,176,532 S676P probably damaging Het
Arntl2 A G 6: 146,809,719 M74V probably benign Het
Arpp21 A T 9: 112,176,251 probably null Het
C1rb A T 6: 124,575,279 I319F possibly damaging Het
C2cd3 T C 7: 100,422,603 V629A Het
Cacna1i T G 15: 80,375,575 F1287C probably damaging Het
Catspere2 A G 1: 178,098,508 I247V probably benign Het
Cd101 C G 3: 101,018,729 A229P probably benign Het
Cdh23 T C 10: 60,305,116 D3151G probably damaging Het
Cenpc1 C A 5: 86,034,353 K557N possibly damaging Het
Col6a4 G A 9: 106,076,892 T416M possibly damaging Het
Cyp2c67 A T 19: 39,640,007 C164* probably null Het
Dopey2 A G 16: 93,747,508 E179G probably benign Het
Duoxa2 A T 2: 122,301,340 Y170F possibly damaging Het
Fras1 A G 5: 96,736,970 K2569R possibly damaging Het
Fsip2 C A 2: 82,983,118 H3260Q probably benign Het
Gm3402 T C 5: 146,515,233 I121T probably benign Het
Herc3 T A 6: 58,876,788 H606Q possibly damaging Het
Hmcn2 T C 2: 31,392,157 V1927A possibly damaging Het
Hnf4g A G 3: 3,652,864 H347R possibly damaging Het
Hs3st3a1 A G 11: 64,520,337 T234A probably benign Het
Hyal1 G T 9: 107,579,160 V379L probably benign Het
Ighv1-19 A G 12: 114,708,951 probably benign Het
Iqcc T A 4: 129,616,708 Q338L not run Het
Kdm5b T C 1: 134,560,439 V34A probably damaging Het
Lgals4 T C 7: 28,841,146 F225L probably benign Het
Lmtk3 C T 7: 45,795,157 T1088I unknown Het
Magel2 A T 7: 62,380,776 S1143C unknown Het
Mapk4 A T 18: 73,937,267 L185Q possibly damaging Het
Ncam1 A G 9: 49,506,911 S1030P Het
Nynrin A T 14: 55,863,914 T347S probably benign Het
Pak7 T C 2: 136,098,299 T532A probably damaging Het
Pcdhb15 A G 18: 37,474,336 E207G probably damaging Het
Pde6h T C 6: 136,963,213 W66R probably damaging Het
Pmaip1 T C 18: 66,458,814 probably null Het
Prkd3 A G 17: 78,954,566 F774S probably damaging Het
Prox1 T A 1: 190,161,845 R134S possibly damaging Het
Ptpn22 T A 3: 103,886,019 H495Q probably damaging Het
Ptprj G T 2: 90,440,782 Q1201K probably benign Het
Rp1l1 A G 14: 64,031,998 S1678G probably benign Het
Sez6l G T 5: 112,576,812 probably null Het
Sgcg T A 14: 61,240,367 Y91F probably damaging Het
Skint2 C T 4: 112,624,218 L93F probably damaging Het
Slc22a22 A T 15: 57,263,375 D99E probably benign Het
Slco3a1 A G 7: 74,284,342 I694T probably damaging Het
Smurf2 A T 11: 106,846,085 I305N possibly damaging Het
Soga1 T C 2: 157,031,005 Q862R possibly damaging Het
Stac3 T A 10: 127,504,900 V178D probably benign Het
Tas2r118 C T 6: 23,969,750 C104Y probably damaging Het
Tom1l2 T G 11: 60,245,165 E327D probably benign Het
Trit1 T C 4: 123,016,779 M57T possibly damaging Het
Vav1 G A 17: 57,296,720 S134N probably benign Het
Vmn2r82 T C 10: 79,378,888 L235P probably damaging Het
Zfp735 T A 11: 73,711,553 V441E possibly damaging Het
Other mutations in Suclg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01892:Suclg2 APN 6 95579188 missense probably damaging 1.00
IGL01904:Suclg2 APN 6 95588934 splice site probably benign
IGL02245:Suclg2 APN 6 95595741 missense possibly damaging 0.54
IGL03268:Suclg2 APN 6 95569592 missense probably damaging 0.99
PIT4576001:Suclg2 UTSW 6 95587018 missense possibly damaging 0.95
R0173:Suclg2 UTSW 6 95475173 splice site probably benign
R1241:Suclg2 UTSW 6 95497582 splice site probably benign
R1654:Suclg2 UTSW 6 95655551 missense probably damaging 1.00
R1712:Suclg2 UTSW 6 95587016 missense probably damaging 1.00
R1929:Suclg2 UTSW 6 95589094 splice site probably benign
R3735:Suclg2 UTSW 6 95497696 missense probably damaging 1.00
R3736:Suclg2 UTSW 6 95497696 missense probably damaging 1.00
R3801:Suclg2 UTSW 6 95497668 missense probably damaging 0.98
R3803:Suclg2 UTSW 6 95497668 missense probably damaging 0.98
R3804:Suclg2 UTSW 6 95497668 missense probably damaging 0.98
R3947:Suclg2 UTSW 6 95579238 splice site probably null
R4768:Suclg2 UTSW 6 95566488 missense probably damaging 0.99
R4953:Suclg2 UTSW 6 95566436 missense probably damaging 1.00
R6140:Suclg2 UTSW 6 95569721 missense probably damaging 1.00
R7105:Suclg2 UTSW 6 95595654 missense possibly damaging 0.92
R7335:Suclg2 UTSW 6 95566460 missense probably damaging 1.00
R7861:Suclg2 UTSW 6 95594722 missense probably benign 0.00
R7944:Suclg2 UTSW 6 95594722 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGACACCCTGAAGTTGCTAATAAG -3'
(R):5'- TCAGGGTACAGATTGGCCTAG -3'

Sequencing Primer
(F):5'- TAGCAGAATTTATACCCGAGGCTG -3'
(R):5'- GATTGGCCTAGAAATGATAGTGTTC -3'
Posted On2019-09-13