Incidental Mutation 'R7335:Pde6h'
ID569432
Institutional Source Beutler Lab
Gene Symbol Pde6h
Ensembl Gene ENSMUSG00000064330
Gene Namephosphodiesterase 6H, cGMP-specific, cone, gamma
SynonymsPDEgamma, A930033D18Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R7335 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location136923832-136968865 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 136963213 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 66 (W66R)
Ref Sequence ENSEMBL: ENSMUSP00000119246 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000137768] [ENSMUST00000204382] [ENSMUST00000204627]
Predicted Effect probably damaging
Transcript: ENSMUST00000137768
AA Change: W66R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000119246
Gene: ENSMUSG00000064330
AA Change: W66R

DomainStartEndE-ValueType
Pfam:PDE6_gamma 2 83 4.7e-52 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000204382
AA Change: L52P
SMART Domains Protein: ENSMUSP00000145119
Gene: ENSMUSG00000064330
AA Change: L52P

DomainStartEndE-ValueType
Pfam:PDE6_gamma 2 56 1.4e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000204627
AA Change: W66R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000145191
Gene: ENSMUSG00000064330
AA Change: W66R

DomainStartEndE-ValueType
Pfam:PDE6_gamma 2 74 1.5e-41 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the inhibitory (or gamma) subunit of the cone-specific cGMP phosphodiesterase, which is a tetramer composed of two catalytic chains (alpha and beta), and two inhibitory chains (gamma). It is specifically expressed in the retina, and is involved in the transmission and amplification of the visual signal. Mutations in this gene are associated with retinal cone dystrophy type 3A (RCD3A). [provided by RefSeq, Mar 2010]
PHENOTYPE: Homozygous mutation of this gene does not affect the retina or photoreceptor function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts2 A G 11: 50,602,266 S35G probably benign Het
Adcy6 G T 15: 98,603,876 Q286K probably benign Het
Agrn A G 4: 156,176,532 S676P probably damaging Het
Arntl2 A G 6: 146,809,719 M74V probably benign Het
Arpp21 A T 9: 112,176,251 probably null Het
C1rb A T 6: 124,575,279 I319F possibly damaging Het
C2cd3 T C 7: 100,422,603 V629A Het
Cacna1i T G 15: 80,375,575 F1287C probably damaging Het
Catspere2 A G 1: 178,098,508 I247V probably benign Het
Cd101 C G 3: 101,018,729 A229P probably benign Het
Cdh23 T C 10: 60,305,116 D3151G probably damaging Het
Cenpc1 C A 5: 86,034,353 K557N possibly damaging Het
Col6a4 G A 9: 106,076,892 T416M possibly damaging Het
Cyp2c67 A T 19: 39,640,007 C164* probably null Het
Dopey2 A G 16: 93,747,508 E179G probably benign Het
Duoxa2 A T 2: 122,301,340 Y170F possibly damaging Het
Fras1 A G 5: 96,736,970 K2569R possibly damaging Het
Fsip2 C A 2: 82,983,118 H3260Q probably benign Het
Gm3402 T C 5: 146,515,233 I121T probably benign Het
Herc3 T A 6: 58,876,788 H606Q possibly damaging Het
Hmcn2 T C 2: 31,392,157 V1927A possibly damaging Het
Hnf4g A G 3: 3,652,864 H347R possibly damaging Het
Hs3st3a1 A G 11: 64,520,337 T234A probably benign Het
Hyal1 G T 9: 107,579,160 V379L probably benign Het
Ighv1-19 A G 12: 114,708,951 probably benign Het
Iqcc T A 4: 129,616,708 Q338L not run Het
Kdm5b T C 1: 134,560,439 V34A probably damaging Het
Lgals4 T C 7: 28,841,146 F225L probably benign Het
Lmtk3 C T 7: 45,795,157 T1088I unknown Het
Magel2 A T 7: 62,380,776 S1143C unknown Het
Mapk4 A T 18: 73,937,267 L185Q possibly damaging Het
Ncam1 A G 9: 49,506,911 S1030P Het
Nynrin A T 14: 55,863,914 T347S probably benign Het
Pak7 T C 2: 136,098,299 T532A probably damaging Het
Pcdhb15 A G 18: 37,474,336 E207G probably damaging Het
Pmaip1 T C 18: 66,458,814 probably null Het
Prkd3 A G 17: 78,954,566 F774S probably damaging Het
Prox1 T A 1: 190,161,845 R134S possibly damaging Het
Ptpn22 T A 3: 103,886,019 H495Q probably damaging Het
Ptprj G T 2: 90,440,782 Q1201K probably benign Het
Rp1l1 A G 14: 64,031,998 S1678G probably benign Het
Sez6l G T 5: 112,576,812 probably null Het
Sgcg T A 14: 61,240,367 Y91F probably damaging Het
Skint2 C T 4: 112,624,218 L93F probably damaging Het
Slc22a22 A T 15: 57,263,375 D99E probably benign Het
Slco3a1 A G 7: 74,284,342 I694T probably damaging Het
Smurf2 A T 11: 106,846,085 I305N possibly damaging Het
Soga1 T C 2: 157,031,005 Q862R possibly damaging Het
Stac3 T A 10: 127,504,900 V178D probably benign Het
Suclg2 T A 6: 95,566,460 N330I probably damaging Het
Suclg2 G A 6: 95,566,463 A329V probably damaging Het
Tas2r118 C T 6: 23,969,750 C104Y probably damaging Het
Tom1l2 T G 11: 60,245,165 E327D probably benign Het
Trit1 T C 4: 123,016,779 M57T possibly damaging Het
Vav1 G A 17: 57,296,720 S134N probably benign Het
Vmn2r82 T C 10: 79,378,888 L235P probably damaging Het
Zfp735 T A 11: 73,711,553 V441E possibly damaging Het
Other mutations in Pde6h
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02488:Pde6h APN 6 136963266 unclassified probably null
IGL03121:Pde6h APN 6 136959282 missense probably null
PIT4151001:Pde6h UTSW 6 136961187 missense possibly damaging 0.48
R1065:Pde6h UTSW 6 136959370 missense probably damaging 1.00
R2001:Pde6h UTSW 6 136963205 missense probably damaging 0.99
R2852:Pde6h UTSW 6 136963208 missense probably damaging 1.00
R4052:Pde6h UTSW 6 136959268 missense unknown
R4964:Pde6h UTSW 6 136961203 missense possibly damaging 0.92
R4966:Pde6h UTSW 6 136961203 missense possibly damaging 0.92
R7629:Pde6h UTSW 6 136959319 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- TTTACATCCTCCATGGCTGTGG -3'
(R):5'- TGGACGACTTCAAAACAGCAG -3'

Sequencing Primer
(F):5'- TCCATGGCTGTGGGGTCC -3'
(R):5'- TAACTCATGGGTCAGGGCCATATAC -3'
Posted On2019-09-13