Incidental Mutation 'R7335:Arntl2'
ID569433
Institutional Source Beutler Lab
Gene Symbol Arntl2
Ensembl Gene ENSMUSG00000040187
Gene Namearyl hydrocarbon receptor nuclear translocator-like 2
SynonymsMOP9, 4632430A05Rik, bHLHe6, BMAL2
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.278) question?
Stock #R7335 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location146796055-146833529 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 146809719 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 74 (M74V)
Ref Sequence ENSEMBL: ENSMUSP00000079373 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080530] [ENSMUST00000111636] [ENSMUST00000111638] [ENSMUST00000111639] [ENSMUST00000129788]
Predicted Effect probably benign
Transcript: ENSMUST00000080530
AA Change: M74V

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000079373
Gene: ENSMUSG00000040187
AA Change: M74V

DomainStartEndE-ValueType
HLH 54 107 6.51e-14 SMART
PAS 122 189 6.2e-7 SMART
PAS 298 364 2.7e-7 SMART
PAC 371 414 1.72e0 SMART
low complexity region 427 438 N/A INTRINSIC
low complexity region 472 483 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111636
AA Change: M74V

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000107263
Gene: ENSMUSG00000040187
AA Change: M74V

DomainStartEndE-ValueType
HLH 54 107 6.51e-14 SMART
PAS 122 189 6.2e-7 SMART
PAS 298 364 2.7e-7 SMART
PAC 371 414 1.72e0 SMART
low complexity region 427 438 N/A INTRINSIC
low complexity region 472 483 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111638
AA Change: M74V

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000107265
Gene: ENSMUSG00000040187
AA Change: M74V

DomainStartEndE-ValueType
HLH 54 107 6.51e-14 SMART
PAS 122 189 6.2e-7 SMART
PAS 298 364 1.29e-4 SMART
PAC 361 404 3.66e0 SMART
low complexity region 417 428 N/A INTRINSIC
low complexity region 462 473 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111639
AA Change: M74V

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000107266
Gene: ENSMUSG00000040187
AA Change: M74V

DomainStartEndE-ValueType
HLH 54 107 6.51e-14 SMART
PAS 122 189 6.2e-7 SMART
PAS 298 364 2.7e-7 SMART
PAC 371 414 1.72e0 SMART
low complexity region 427 438 N/A INTRINSIC
low complexity region 472 483 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129788
AA Change: M74V

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000121170
Gene: ENSMUSG00000040187
AA Change: M74V

DomainStartEndE-ValueType
HLH 54 107 6.51e-14 SMART
PAS 122 189 6.2e-7 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: This gene encodes a basic helix-loop-helix transcription factor belonging to the PAS (Per, Arnt, Sim) superfamily. The PAS proteins play important roles in adaptation to low atmospheric and cellular oxygen levels, exposure to certain environmental pollutants, and diurnal oscillations in light and temperature. This protein forms a transcriptionally active heterodimer with the circadian Clock protein, the structurally related Mop4, and hypoxia-inducible factors, such as Hif1alpha. Consistent with its role as a biologically relevant partner of circadian and hypoxia factors, this protein is coexpressed in regions of the brain such as the thalamus, hypothalamus, and amygdala. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Feb 2014]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts2 A G 11: 50,602,266 S35G probably benign Het
Adcy6 G T 15: 98,603,876 Q286K probably benign Het
Agrn A G 4: 156,176,532 S676P probably damaging Het
Arpp21 A T 9: 112,176,251 probably null Het
C1rb A T 6: 124,575,279 I319F possibly damaging Het
C2cd3 T C 7: 100,422,603 V629A Het
Cacna1i T G 15: 80,375,575 F1287C probably damaging Het
Catspere2 A G 1: 178,098,508 I247V probably benign Het
Cd101 C G 3: 101,018,729 A229P probably benign Het
Cdh23 T C 10: 60,305,116 D3151G probably damaging Het
Cenpc1 C A 5: 86,034,353 K557N possibly damaging Het
Col6a4 G A 9: 106,076,892 T416M possibly damaging Het
Cyp2c67 A T 19: 39,640,007 C164* probably null Het
Dopey2 A G 16: 93,747,508 E179G probably benign Het
Duoxa2 A T 2: 122,301,340 Y170F possibly damaging Het
Fras1 A G 5: 96,736,970 K2569R possibly damaging Het
Fsip2 C A 2: 82,983,118 H3260Q probably benign Het
Gm3402 T C 5: 146,515,233 I121T probably benign Het
Herc3 T A 6: 58,876,788 H606Q possibly damaging Het
Hmcn2 T C 2: 31,392,157 V1927A possibly damaging Het
Hnf4g A G 3: 3,652,864 H347R possibly damaging Het
Hs3st3a1 A G 11: 64,520,337 T234A probably benign Het
Hyal1 G T 9: 107,579,160 V379L probably benign Het
Ighv1-19 A G 12: 114,708,951 probably benign Het
Iqcc T A 4: 129,616,708 Q338L not run Het
Kdm5b T C 1: 134,560,439 V34A probably damaging Het
Lgals4 T C 7: 28,841,146 F225L probably benign Het
Lmtk3 C T 7: 45,795,157 T1088I unknown Het
Magel2 A T 7: 62,380,776 S1143C unknown Het
Mapk4 A T 18: 73,937,267 L185Q possibly damaging Het
Ncam1 A G 9: 49,506,911 S1030P Het
Nynrin A T 14: 55,863,914 T347S probably benign Het
Pak7 T C 2: 136,098,299 T532A probably damaging Het
Pcdhb15 A G 18: 37,474,336 E207G probably damaging Het
Pde6h T C 6: 136,963,213 W66R probably damaging Het
Pmaip1 T C 18: 66,458,814 probably null Het
Prkd3 A G 17: 78,954,566 F774S probably damaging Het
Prox1 T A 1: 190,161,845 R134S possibly damaging Het
Ptpn22 T A 3: 103,886,019 H495Q probably damaging Het
Ptprj G T 2: 90,440,782 Q1201K probably benign Het
Rp1l1 A G 14: 64,031,998 S1678G probably benign Het
Sez6l G T 5: 112,576,812 probably null Het
Sgcg T A 14: 61,240,367 Y91F probably damaging Het
Skint2 C T 4: 112,624,218 L93F probably damaging Het
Slc22a22 A T 15: 57,263,375 D99E probably benign Het
Slco3a1 A G 7: 74,284,342 I694T probably damaging Het
Smurf2 A T 11: 106,846,085 I305N possibly damaging Het
Soga1 T C 2: 157,031,005 Q862R possibly damaging Het
Stac3 T A 10: 127,504,900 V178D probably benign Het
Suclg2 T A 6: 95,566,460 N330I probably damaging Het
Suclg2 G A 6: 95,566,463 A329V probably damaging Het
Tas2r118 C T 6: 23,969,750 C104Y probably damaging Het
Tom1l2 T G 11: 60,245,165 E327D probably benign Het
Trit1 T C 4: 123,016,779 M57T possibly damaging Het
Vav1 G A 17: 57,296,720 S134N probably benign Het
Vmn2r82 T C 10: 79,378,888 L235P probably damaging Het
Zfp735 T A 11: 73,711,553 V441E possibly damaging Het
Other mutations in Arntl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00477:Arntl2 APN 6 146827329 splice site probably benign
IGL00481:Arntl2 APN 6 146809666 missense probably benign 0.11
IGL02141:Arntl2 APN 6 146828095 splice site probably benign
IGL02402:Arntl2 APN 6 146809768 missense possibly damaging 0.90
R0054:Arntl2 UTSW 6 146829718 missense probably benign 0.01
R0054:Arntl2 UTSW 6 146829718 missense probably benign 0.01
R0131:Arntl2 UTSW 6 146828103 missense probably benign 0.00
R0403:Arntl2 UTSW 6 146822655 missense probably damaging 1.00
R0716:Arntl2 UTSW 6 146829720 missense possibly damaging 0.82
R0799:Arntl2 UTSW 6 146823253 splice site probably benign
R0834:Arntl2 UTSW 6 146822687 missense probably damaging 1.00
R1909:Arntl2 UTSW 6 146810810 missense probably benign 0.01
R2270:Arntl2 UTSW 6 146822114 missense probably damaging 1.00
R2272:Arntl2 UTSW 6 146822114 missense probably damaging 1.00
R3715:Arntl2 UTSW 6 146822689 missense probably damaging 0.97
R4370:Arntl2 UTSW 6 146809651 missense probably damaging 1.00
R5399:Arntl2 UTSW 6 146822661 missense probably damaging 0.99
R5894:Arntl2 UTSW 6 146823234 missense possibly damaging 0.93
R5972:Arntl2 UTSW 6 146809689 missense probably damaging 0.99
R6090:Arntl2 UTSW 6 146829696 missense possibly damaging 0.90
R6111:Arntl2 UTSW 6 146820599 missense probably benign 0.16
R6279:Arntl2 UTSW 6 146821946 missense probably damaging 1.00
R6300:Arntl2 UTSW 6 146821946 missense probably damaging 1.00
R6452:Arntl2 UTSW 6 146823207 missense probably benign 0.00
R6722:Arntl2 UTSW 6 146818900 missense probably damaging 0.99
R7296:Arntl2 UTSW 6 146822134 missense not run
R7481:Arntl2 UTSW 6 146818871 missense not run
R7655:Arntl2 UTSW 6 146806442 missense probably benign 0.31
R7656:Arntl2 UTSW 6 146806442 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- GCTCTGAATGATGGGGTGAAC -3'
(R):5'- AAATCTTCACGGCCAGGACC -3'

Sequencing Primer
(F):5'- TGAACAAGCCAAGGAGGTCC -3'
(R):5'- CAACCAGAGTAACAGCATCCTGG -3'
Posted On2019-09-13