Mutagenetix > Incidental Mutations

Incidental Mutation 'R7335:Ncam1'

569439

Institutional Source

Beutler Lab

Gene Symbol

Ncam1

Ensembl Gene

ENSMUSG00000039542

Gene Name

neural cell adhesion molecule 1

Synonyms

NCAM-140, E-NCAM, NCAM-180, NCAM-1, CD56, NCAM-120, NCAM

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.899) question?

Stock #

R7335 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

49502136-49798925 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 49506911 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 1030 (S1030P)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000166811] [ENSMUST00000193547]

Predicted Effect

probably benign
Transcript: ENSMUST00000166811

SMART Domains

Protein: ENSMUSP00000130668
Gene: ENSMUSG00000039542

Domain	Start	End	E-Value	Type
IGc2	32	103	2.88e-4	SMART
IGc2	130	196	6.35e-6	SMART
IGc2	226	295	6.38e-20	SMART
IGc2	321	393	4.12e-14	SMART
IGc2	418	487	9.7e-11	SMART
FN3	501	586	4.77e-8	SMART
FN3	602	683	6.97e-1	SMART
transmembrane domain	706	728	N/A	INTRINSIC
low complexity region	797	809	N/A	INTRINSIC
low complexity region	814	830	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000193547

SMART Domains

Protein: ENSMUSP00000142275
Gene: ENSMUSG00000039542

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
IGc2	32	103	2.88e-4	SMART
IGc2	130	196	6.35e-6	SMART
IGc2	226	295	6.38e-20	SMART
IGc2	321	393	4.12e-14	SMART
IGc2	418	487	9.7e-11	SMART
FN3	501	586	4.77e-8	SMART
FN3	602	683	6.97e-1	SMART
transmembrane domain	706	728	N/A	INTRINSIC
low complexity region	797	809	N/A	INTRINSIC
low complexity region	814	830	N/A	INTRINSIC

Predicted Effect

Meta Mutation Damage Score

0.0852

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (56/56)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cell adhesion protein which is a member of the immunoglobulin superfamily. The encoded protein is involved in cell-to-cell interactions as well as cell-matrix interactions during development and differentiation. The encoded protein has been shown to be involved in development of the nervous system, and for cells involved in the expansion of T cells and dendritic cells which play an important role in immune surveillance. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2011]
PHENOTYPE: Homozygous mutants show impairment in Morris water maze test, reduced brain and olfactory bulb size, hypoplasic corticospinal tract, abnormally distributed anterior pituitary cell types, and morphological and functional defects of neuromuscular junctions. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts2	A	G	11: 50,602,266	S35G	probably benign	Het
Adcy6	G	T	15: 98,603,876	Q286K	probably benign	Het
Agrn	A	G	4: 156,176,532	S676P	probably damaging	Het
Arntl2	A	G	6: 146,809,719	M74V	probably benign	Het
Arpp21	A	T	9: 112,176,251		probably null	Het
C1rb	A	T	6: 124,575,279	I319F	possibly damaging	Het
C2cd3	T	C	7: 100,422,603	V629A		Het
Cacna1i	T	G	15: 80,375,575	F1287C	probably damaging	Het
Catspere2	A	G	1: 178,098,508	I247V	probably benign	Het
Cd101	C	G	3: 101,018,729	A229P	probably benign	Het
Cdh23	T	C	10: 60,305,116	D3151G	probably damaging	Het
Cenpc1	C	A	5: 86,034,353	K557N	possibly damaging	Het
Col6a4	G	A	9: 106,076,892	T416M	possibly damaging	Het
Cyp2c67	A	T	19: 39,640,007	C164*	probably null	Het
Dopey2	A	G	16: 93,747,508	E179G	probably benign	Het
Duoxa2	A	T	2: 122,301,340	Y170F	possibly damaging	Het
Fras1	A	G	5: 96,736,970	K2569R	possibly damaging	Het
Fsip2	C	A	2: 82,983,118	H3260Q	probably benign	Het
Gm3402	T	C	5: 146,515,233	I121T	probably benign	Het
Herc3	T	A	6: 58,876,788	H606Q	possibly damaging	Het
Hmcn2	T	C	2: 31,392,157	V1927A	possibly damaging	Het
Hnf4g	A	G	3: 3,652,864	H347R	possibly damaging	Het
Hs3st3a1	A	G	11: 64,520,337	T234A	probably benign	Het
Hyal1	G	T	9: 107,579,160	V379L	probably benign	Het
Ighv1-19	A	G	12: 114,708,951		probably benign	Het
Iqcc	T	A	4: 129,616,708	Q338L	not run	Het
Kdm5b	T	C	1: 134,560,439	V34A	probably damaging	Het
Lgals4	T	C	7: 28,841,146	F225L	probably benign	Het
Lmtk3	C	T	7: 45,795,157	T1088I	unknown	Het
Magel2	A	T	7: 62,380,776	S1143C	unknown	Het
Mapk4	A	T	18: 73,937,267	L185Q	possibly damaging	Het
Nynrin	A	T	14: 55,863,914	T347S	probably benign	Het
Pak7	T	C	2: 136,098,299	T532A	probably damaging	Het
Pcdhb15	A	G	18: 37,474,336	E207G	probably damaging	Het
Pde6h	T	C	6: 136,963,213	W66R	probably damaging	Het
Pmaip1	T	C	18: 66,458,814		probably null	Het
Prkd3	A	G	17: 78,954,566	F774S	probably damaging	Het
Prox1	T	A	1: 190,161,845	R134S	possibly damaging	Het
Ptpn22	T	A	3: 103,886,019	H495Q	probably damaging	Het
Ptprj	G	T	2: 90,440,782	Q1201K	probably benign	Het
Rp1l1	A	G	14: 64,031,998	S1678G	probably benign	Het
Sez6l	G	T	5: 112,576,812		probably null	Het
Sgcg	T	A	14: 61,240,367	Y91F	probably damaging	Het
Skint2	C	T	4: 112,624,218	L93F	probably damaging	Het
Slc22a22	A	T	15: 57,263,375	D99E	probably benign	Het
Slco3a1	A	G	7: 74,284,342	I694T	probably damaging	Het
Smurf2	A	T	11: 106,846,085	I305N	possibly damaging	Het
Soga1	T	C	2: 157,031,005	Q862R	possibly damaging	Het
Stac3	T	A	10: 127,504,900	V178D	probably benign	Het
Suclg2	T	A	6: 95,566,460	N330I	probably damaging	Het
Suclg2	G	A	6: 95,566,463	A329V	probably damaging	Het
Tas2r118	C	T	6: 23,969,750	C104Y	probably damaging	Het
Tom1l2	T	G	11: 60,245,165	E327D	probably benign	Het
Trit1	T	C	4: 123,016,779	M57T	possibly damaging	Het
Vav1	G	A	17: 57,296,720	S134N	probably benign	Het
Vmn2r82	T	C	10: 79,378,888	L235P	probably damaging	Het
Zfp735	T	A	11: 73,711,553	V441E	possibly damaging	Het

Other mutations in Ncam1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00592:Ncam1	APN	9	49523565	missense	probably damaging	1.00
IGL01384:Ncam1	APN	9	49509852	missense	possibly damaging	0.76
IGL01798:Ncam1	APN	9	49508607	missense	probably damaging	1.00
IGL02239:Ncam1	APN	9	49567402	missense	probably damaging	1.00
IGL02368:Ncam1	APN	9	49543083	nonsense	probably null
IGL02616:Ncam1	APN	9	49508688	missense	probably benign	0.23
PIT4431001:Ncam1	UTSW	9	49798693	missense	probably benign	0.04
R0164:Ncam1	UTSW	9	49568409	missense	probably damaging	1.00
R0164:Ncam1	UTSW	9	49568409	missense	probably damaging	1.00
R0502:Ncam1	UTSW	9	49569818	unclassified	probably benign
R0924:Ncam1	UTSW	9	49562176	intron	probably benign
R1398:Ncam1	UTSW	9	49517589	intron	probably benign
R1440:Ncam1	UTSW	9	49544800	missense	probably damaging	1.00
R1491:Ncam1	UTSW	9	49505549	missense	probably benign	0.15
R1676:Ncam1	UTSW	9	49557172	missense	probably damaging	1.00
R1743:Ncam1	UTSW	9	49557145	missense	probably damaging	1.00
R1769:Ncam1	UTSW	9	49545256	unclassified	probably benign
R1951:Ncam1	UTSW	9	49545192	missense	probably benign	0.36
R2143:Ncam1	UTSW	9	49543019	missense	possibly damaging	0.87
R2167:Ncam1	UTSW	9	49568481	missense	probably benign	0.42
R2170:Ncam1	UTSW	9	49798681	missense	probably benign	0.06
R2290:Ncam1	UTSW	9	49523651	splice site	probably benign
R2321:Ncam1	UTSW	9	49544832	unclassified	probably benign
R3001:Ncam1	UTSW	9	49557226	missense	probably damaging	0.99
R3002:Ncam1	UTSW	9	49557226	missense	probably damaging	0.99
R4026:Ncam1	UTSW	9	49564995	missense	probably benign	0.00
R4279:Ncam1	UTSW	9	49506959	intron	probably benign
R4289:Ncam1	UTSW	9	49557172	missense	probably damaging	1.00
R4873:Ncam1	UTSW	9	49507621	intron	probably benign
R4875:Ncam1	UTSW	9	49507621	intron	probably benign
R4883:Ncam1	UTSW	9	49541883	splice site	probably null
R4899:Ncam1	UTSW	9	49545251	critical splice acceptor site	probably null
R4923:Ncam1	UTSW	9	49505479	missense	probably benign
R5041:Ncam1	UTSW	9	49566785	missense	probably damaging	1.00
R5058:Ncam1	UTSW	9	49798695	missense	probably benign	0.16
R5386:Ncam1	UTSW	9	49564874	missense	probably damaging	1.00
R5388:Ncam1	UTSW	9	49544754	missense	probably benign
R5512:Ncam1	UTSW	9	49509699	splice site	probably null
R5598:Ncam1	UTSW	9	49545751	missense	probably damaging	1.00
R5895:Ncam1	UTSW	9	49507043	missense	probably benign
R5972:Ncam1	UTSW	9	49507529	missense	possibly damaging	0.93
R6059:Ncam1	UTSW	9	49544666	missense	probably damaging	1.00
R6226:Ncam1	UTSW	9	49565004	missense	probably benign	0.00
R6392:Ncam1	UTSW	9	49523575	missense	probably damaging	0.99
R6750:Ncam1	UTSW	9	49567339	missense	probably damaging	1.00
R6799:Ncam1	UTSW	9	49508611	missense	probably damaging	0.99
R7230:Ncam1	UTSW	9	49509823	missense	probably benign	0.00
R7561:Ncam1	UTSW	9	49564942	missense	probably damaging	1.00
R7645:Ncam1	UTSW	9	49565003	missense	probably benign	0.01
R8022:Ncam1	UTSW	9	49564892	missense	possibly damaging	0.72
R8023:Ncam1	UTSW	9	49509757	missense	probably benign	0.00
R8045:Ncam1	UTSW	9	49507436	missense
R8234:Ncam1	UTSW	9	49545223	missense	probably damaging	0.99
R8308:Ncam1	UTSW	9	49568517	missense	probably damaging	0.99
R8370:Ncam1	UTSW	9	49557131	nonsense	probably null
X0062:Ncam1	UTSW	9	49545601	nonsense	probably null
X0064:Ncam1	UTSW	9	49566680	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCACAGAAGCCCTGCAAGAG -3'
(R):5'- GCTGTACTCAGTCCTAGCAC -3'

Sequencing Primer
(F):5'- GGCTGAGGACACATCGAACAC -3'
(R):5'- AGCCCCTTAGCAGCAGTAG -3'

Posted On

2019-09-13