Mutagenetix > Incidental Mutations

Incidental Mutation 'R7335:Col6a4'

569440

Institutional Source

Beutler Lab

Gene Symbol

Col6a4

Ensembl Gene

ENSMUSG00000032572

Gene Name

collagen, type VI, alpha 4

Synonyms

Vwa6, 1110001D15Rik, EG235580, Dvwa

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7335 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

105989454-106096783 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 106076892 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Methionine at position 416 (T416M)

Ref Sequence

ENSEMBL: ENSMUSP00000112472 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000121963]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000121963
AA Change: T416M

PolyPhen 2 Score 0.903 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000112472
Gene: ENSMUSG00000032572
AA Change: T416M

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
VWA	32	211	2.44e-35	SMART
VWA	233	410	8.67e-50	SMART
VWA	428	604	2.74e-29	SMART
VWA	632	816	4.78e-20	SMART
VWA	847	1019	3.02e-40	SMART
VWA	1028	1204	3.17e-43	SMART
VWA	1210	1391	4.73e-1	SMART
low complexity region	1444	1462	N/A	INTRINSIC
PDB:3HR2\|B	1469	1593	3e-7	PDB
low complexity region	1594	1622	N/A	INTRINSIC
low complexity region	1625	1643	N/A	INTRINSIC
low complexity region	1649	1671	N/A	INTRINSIC
Pfam:Collagen	1684	1748	1.4e-9	PFAM
VWA	1774	1953	2.18e-14	SMART
VWA	1980	2174	1.89e-9	SMART

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (56/56)

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts2	A	G	11: 50,602,266	S35G	probably benign	Het
Adcy6	G	T	15: 98,603,876	Q286K	probably benign	Het
Agrn	A	G	4: 156,176,532	S676P	probably damaging	Het
Arntl2	A	G	6: 146,809,719	M74V	probably benign	Het
Arpp21	A	T	9: 112,176,251		probably null	Het
C1rb	A	T	6: 124,575,279	I319F	possibly damaging	Het
C2cd3	T	C	7: 100,422,603	V629A		Het
Cacna1i	T	G	15: 80,375,575	F1287C	probably damaging	Het
Catspere2	A	G	1: 178,098,508	I247V	probably benign	Het
Cd101	C	G	3: 101,018,729	A229P	probably benign	Het
Cdh23	T	C	10: 60,305,116	D3151G	probably damaging	Het
Cenpc1	C	A	5: 86,034,353	K557N	possibly damaging	Het
Cyp2c67	A	T	19: 39,640,007	C164*	probably null	Het
Dopey2	A	G	16: 93,747,508	E179G	probably benign	Het
Duoxa2	A	T	2: 122,301,340	Y170F	possibly damaging	Het
Fras1	A	G	5: 96,736,970	K2569R	possibly damaging	Het
Fsip2	C	A	2: 82,983,118	H3260Q	probably benign	Het
Gm3402	T	C	5: 146,515,233	I121T	probably benign	Het
Herc3	T	A	6: 58,876,788	H606Q	possibly damaging	Het
Hmcn2	T	C	2: 31,392,157	V1927A	possibly damaging	Het
Hnf4g	A	G	3: 3,652,864	H347R	possibly damaging	Het
Hs3st3a1	A	G	11: 64,520,337	T234A	probably benign	Het
Hyal1	G	T	9: 107,579,160	V379L	probably benign	Het
Ighv1-19	A	G	12: 114,708,951		probably benign	Het
Iqcc	T	A	4: 129,616,708	Q338L	not run	Het
Kdm5b	T	C	1: 134,560,439	V34A	probably damaging	Het
Lgals4	T	C	7: 28,841,146	F225L	probably benign	Het
Lmtk3	C	T	7: 45,795,157	T1088I	unknown	Het
Magel2	A	T	7: 62,380,776	S1143C	unknown	Het
Mapk4	A	T	18: 73,937,267	L185Q	possibly damaging	Het
Ncam1	A	G	9: 49,506,911	S1030P		Het
Nynrin	A	T	14: 55,863,914	T347S	probably benign	Het
Pak7	T	C	2: 136,098,299	T532A	probably damaging	Het
Pcdhb15	A	G	18: 37,474,336	E207G	probably damaging	Het
Pde6h	T	C	6: 136,963,213	W66R	probably damaging	Het
Pmaip1	T	C	18: 66,458,814		probably null	Het
Prkd3	A	G	17: 78,954,566	F774S	probably damaging	Het
Prox1	T	A	1: 190,161,845	R134S	possibly damaging	Het
Ptpn22	T	A	3: 103,886,019	H495Q	probably damaging	Het
Ptprj	G	T	2: 90,440,782	Q1201K	probably benign	Het
Rp1l1	A	G	14: 64,031,998	S1678G	probably benign	Het
Sez6l	G	T	5: 112,576,812		probably null	Het
Sgcg	T	A	14: 61,240,367	Y91F	probably damaging	Het
Skint2	C	T	4: 112,624,218	L93F	probably damaging	Het
Slc22a22	A	T	15: 57,263,375	D99E	probably benign	Het
Slco3a1	A	G	7: 74,284,342	I694T	probably damaging	Het
Smurf2	A	T	11: 106,846,085	I305N	possibly damaging	Het
Soga1	T	C	2: 157,031,005	Q862R	possibly damaging	Het
Stac3	T	A	10: 127,504,900	V178D	probably benign	Het
Suclg2	T	A	6: 95,566,460	N330I	probably damaging	Het
Suclg2	G	A	6: 95,566,463	A329V	probably damaging	Het
Tas2r118	C	T	6: 23,969,750	C104Y	probably damaging	Het
Tom1l2	T	G	11: 60,245,165	E327D	probably benign	Het
Trit1	T	C	4: 123,016,779	M57T	possibly damaging	Het
Vav1	G	A	17: 57,296,720	S134N	probably benign	Het
Vmn2r82	T	C	10: 79,378,888	L235P	probably damaging	Het
Zfp735	T	A	11: 73,711,553	V441E	possibly damaging	Het

Other mutations in Col6a4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00573:Col6a4	APN	9	106022896	missense	probably benign	0.00
IGL00691:Col6a4	APN	9	106057407	missense	probably damaging	1.00
IGL01508:Col6a4	APN	9	106013605	missense	possibly damaging	0.95
IGL01580:Col6a4	APN	9	106068198	missense	probably damaging	1.00
IGL01610:Col6a4	APN	9	106047707	splice site	probably benign
IGL01813:Col6a4	APN	9	106077253	missense	probably damaging	1.00
IGL01933:Col6a4	APN	9	106060114	missense	probably benign	0.04
IGL01973:Col6a4	APN	9	106062894	missense	probably damaging	1.00
IGL02053:Col6a4	APN	9	106063095	missense	possibly damaging	0.92
IGL02063:Col6a4	APN	9	106057418	missense	probably benign	0.01
IGL02065:Col6a4	APN	9	106077103	missense	probably damaging	0.99
IGL02106:Col6a4	APN	9	106063105	missense	possibly damaging	0.95
IGL02220:Col6a4	APN	9	106062942	missense	possibly damaging	0.91
IGL02228:Col6a4	APN	9	106068078	missense	probably benign
IGL02234:Col6a4	APN	9	106013432	missense	possibly damaging	0.92
IGL02294:Col6a4	APN	9	106066732	missense	probably benign	0.04
IGL02314:Col6a4	APN	9	105997156	missense	probably damaging	0.99
IGL03065:Col6a4	APN	9	106041164	splice site	probably benign
IGL03086:Col6a4	APN	9	106082862	splice site	probably benign
IGL03185:Col6a4	APN	9	106019454	missense	probably damaging	0.97
R0092:Col6a4	UTSW	9	106013314	missense	probably benign	0.04
R0095:Col6a4	UTSW	9	106075356	missense	probably benign	0.03
R0230:Col6a4	UTSW	9	106072366	missense	probably benign	0.11
R0359:Col6a4	UTSW	9	105997146	missense	probably benign
R0415:Col6a4	UTSW	9	106075080	missense	probably damaging	0.99
R0433:Col6a4	UTSW	9	106067994	missense	probably damaging	0.99
R0450:Col6a4	UTSW	9	106080547	missense	probably damaging	1.00
R0469:Col6a4	UTSW	9	106080547	missense	probably damaging	1.00
R0490:Col6a4	UTSW	9	106013770	missense	probably damaging	0.99
R0621:Col6a4	UTSW	9	106066791	missense	probably damaging	0.97
R0667:Col6a4	UTSW	9	106029959	splice site	probably benign
R0681:Col6a4	UTSW	9	106067144	nonsense	probably null
R0690:Col6a4	UTSW	9	106028187	splice site	probably benign
R0714:Col6a4	UTSW	9	106017903	unclassified	probably benign
R0788:Col6a4	UTSW	9	106071998	missense	probably benign	0.15
R1036:Col6a4	UTSW	9	106068198	missense	probably damaging	1.00
R1296:Col6a4	UTSW	9	106062853	missense	possibly damaging	0.47
R1386:Col6a4	UTSW	9	106062945	missense	probably benign	0.15
R1484:Col6a4	UTSW	9	106013302	critical splice donor site	probably null
R1528:Col6a4	UTSW	9	106075220	missense	probably damaging	0.99
R1555:Col6a4	UTSW	9	106000886	missense	possibly damaging	0.93
R1622:Col6a4	UTSW	9	105997135	missense	probably benign	0.01
R1653:Col6a4	UTSW	9	106072409	missense	probably damaging	0.99
R1720:Col6a4	UTSW	9	106026472	missense	probably damaging	1.00
R1768:Col6a4	UTSW	9	106080100	missense	probably benign
R1941:Col6a4	UTSW	9	106075010	missense	probably benign	0.00
R2092:Col6a4	UTSW	9	106060331	missense	probably damaging	1.00
R2134:Col6a4	UTSW	9	106066661	missense	probably benign	0.09
R2149:Col6a4	UTSW	9	106076929	missense	probably benign	0.00
R2174:Col6a4	UTSW	9	106060132	missense	probably damaging	0.98
R2204:Col6a4	UTSW	9	106060132	missense	probably damaging	0.98
R2248:Col6a4	UTSW	9	106079959	missense	probably benign	0.15
R2568:Col6a4	UTSW	9	106063076	missense	possibly damaging	0.90
R3750:Col6a4	UTSW	9	106020665	critical splice acceptor site	probably null
R3751:Col6a4	UTSW	9	106072114	missense	probably damaging	0.98
R3776:Col6a4	UTSW	9	106051701	nonsense	probably null
R3872:Col6a4	UTSW	9	106013659	missense	possibly damaging	0.95
R4043:Col6a4	UTSW	9	106072411	nonsense	probably null
R4056:Col6a4	UTSW	9	106026466	missense	probably damaging	0.98
R4212:Col6a4	UTSW	9	106075370	missense	probably benign	0.28
R4417:Col6a4	UTSW	9	106072016	missense	probably damaging	0.99
R4683:Col6a4	UTSW	9	106080130	missense	probably benign	0.00
R4719:Col6a4	UTSW	9	106068252	missense	probably damaging	0.99
R4791:Col6a4	UTSW	9	106080202	missense	possibly damaging	0.68
R4833:Col6a4	UTSW	9	106071979	missense	probably benign	0.00
R4886:Col6a4	UTSW	9	106060072	missense	probably benign	0.00
R4998:Col6a4	UTSW	9	105990778	utr 3 prime	probably benign
R5091:Col6a4	UTSW	9	106075063	missense	probably damaging	1.00
R5113:Col6a4	UTSW	9	106066960	missense	possibly damaging	0.89
R5129:Col6a4	UTSW	9	106013377	missense	probably damaging	0.98
R5231:Col6a4	UTSW	9	106025531	missense	probably damaging	0.96
R5297:Col6a4	UTSW	9	106074867	missense	probably benign	0.02
R5352:Col6a4	UTSW	9	106061544	missense	probably damaging	1.00
R5438:Col6a4	UTSW	9	106013696	missense	possibly damaging	0.95
R5518:Col6a4	UTSW	9	106072188	missense	possibly damaging	0.68
R5657:Col6a4	UTSW	9	106072198	missense	probably damaging	0.99
R5660:Col6a4	UTSW	9	105996116	missense	probably benign	0.01
R5662:Col6a4	UTSW	9	106068001	missense	probably damaging	0.99
R5777:Col6a4	UTSW	9	106013696	missense	possibly damaging	0.95
R5800:Col6a4	UTSW	9	106080275	missense	probably damaging	0.99
R5929:Col6a4	UTSW	9	106063044	missense	probably benign	0.15
R5999:Col6a4	UTSW	9	106067921	missense	probably benign	0.11
R6243:Col6a4	UTSW	9	106013390	missense	possibly damaging	0.95
R6285:Col6a4	UTSW	9	106074986	missense	probably damaging	0.96
R6288:Col6a4	UTSW	9	106068263	missense	probably damaging	0.99
R6361:Col6a4	UTSW	9	106066703	missense	probably benign	0.28
R6485:Col6a4	UTSW	9	106076870	critical splice donor site	probably null
R6490:Col6a4	UTSW	9	106074992	nonsense	probably null
R6537:Col6a4	UTSW	9	106067954	missense	possibly damaging	0.87
R6598:Col6a4	UTSW	9	106000412	missense	probably damaging	0.99
R6643:Col6a4	UTSW	9	106000631	missense	probably damaging	0.96
R6905:Col6a4	UTSW	9	106060318	splice site	probably null
R6944:Col6a4	UTSW	9	106072171	missense	probably damaging	0.98
R7015:Col6a4	UTSW	9	106033755	critical splice donor site	probably null
R7027:Col6a4	UTSW	9	106067014	missense	probably damaging	1.00
R7088:Col6a4	UTSW	9	106000686	missense	possibly damaging	0.56
R7200:Col6a4	UTSW	9	106072249	missense	possibly damaging	0.68
R7238:Col6a4	UTSW	9	106000320	missense	probably damaging	0.99
R7273:Col6a4	UTSW	9	106000457	missense	possibly damaging	0.92
R7418:Col6a4	UTSW	9	106022915	missense	probably damaging	1.00
R7421:Col6a4	UTSW	9	106020795	missense	probably damaging	0.99
R7530:Col6a4	UTSW	9	106068390	missense	probably damaging	0.99
R7600:Col6a4	UTSW	9	106066999	missense	possibly damaging	0.86
R7701:Col6a4	UTSW	9	106082888	missense	probably benign	0.17
R7830:Col6a4	UTSW	9	106075390	missense	probably damaging	0.99
R7881:Col6a4	UTSW	9	106080298	missense	probably benign	0.14
R7964:Col6a4	UTSW	9	106080298	missense	probably benign	0.14
RF022:Col6a4	UTSW	9	106077008	missense	probably damaging	0.99
X0025:Col6a4	UTSW	9	106000455	missense	probably damaging	0.99
Z1176:Col6a4	UTSW	9	106000797	missense	probably benign
Z1176:Col6a4	UTSW	9	106000870	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- ACCGCCTTTTGGAGTTCAGG -3'
(R):5'- CAGTGATGAGGTCCAGGATG -3'

Sequencing Primer
(F):5'- TAAAAGTATGACTTCTCTACCCCAG -3'
(R):5'- AAGAGACGGGGTCTTTGT -3'

Posted On

2019-09-13