Incidental Mutation 'R7335:Tom1l2'
ID569446
Institutional Source Beutler Lab
Gene Symbol Tom1l2
Ensembl Gene ENSMUSG00000000538
Gene Nametarget of myb1-like 2 (chicken)
SynonymsA730055F12Rik, myb1-like protein 2, 2900016I08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.269) question?
Stock #R7335 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location60226714-60352905 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 60245165 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 327 (E327D)
Ref Sequence ENSEMBL: ENSMUSP00000099744 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064019] [ENSMUST00000093046] [ENSMUST00000093048] [ENSMUST00000095254] [ENSMUST00000102682] [ENSMUST00000102683]
Predicted Effect probably benign
Transcript: ENSMUST00000064019
AA Change: E327D

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000063414
Gene: ENSMUSG00000000538
AA Change: E327D

DomainStartEndE-ValueType
VHS 13 148 1.88e-68 SMART
low complexity region 187 202 N/A INTRINSIC
Pfam:GAT 216 317 1.7e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000093046
AA Change: E277D

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000090734
Gene: ENSMUSG00000000538
AA Change: E277D

DomainStartEndE-ValueType
Pfam:VHS 7 73 1.3e-19 PFAM
low complexity region 137 152 N/A INTRINSIC
Pfam:GAT 166 267 3e-36 PFAM
low complexity region 428 443 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000093048
AA Change: E282D

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000090736
Gene: ENSMUSG00000000538
AA Change: E282D

DomainStartEndE-ValueType
VHS 13 154 1.8e-47 SMART
Pfam:GAT 171 272 3e-36 PFAM
low complexity region 433 448 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000095254
AA Change: E327D

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000092884
Gene: ENSMUSG00000000538
AA Change: E327D

DomainStartEndE-ValueType
VHS 13 148 1.88e-68 SMART
low complexity region 187 202 N/A INTRINSIC
Pfam:GAT 216 317 2e-36 PFAM
low complexity region 458 473 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102682
AA Change: E327D

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000099743
Gene: ENSMUSG00000000538
AA Change: E327D

DomainStartEndE-ValueType
VHS 13 148 1.88e-68 SMART
low complexity region 187 202 N/A INTRINSIC
Pfam:GAT 216 317 1.7e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102683
AA Change: E327D

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000099744
Gene: ENSMUSG00000000538
AA Change: E327D

DomainStartEndE-ValueType
VHS 13 148 1.88e-68 SMART
low complexity region 187 202 N/A INTRINSIC
Pfam:GAT 232 308 1e-26 PFAM
low complexity region 478 493 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000133420
SMART Domains Protein: ENSMUSP00000117623
Gene: ENSMUSG00000000538

DomainStartEndE-ValueType
low complexity region 170 185 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000121936
Gene: ENSMUSG00000000538
AA Change: E18D

DomainStartEndE-ValueType
low complexity region 150 165 N/A INTRINSIC
Meta Mutation Damage Score 0.0873 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (56/56)
MGI Phenotype PHENOTYPE: Mice homozygous for a hypomorphic gene trap allele show malocclusion, kyphosis, hydrocephaly, patchy hair, splenomegaly, high B- and T-cell counts, thrombopenia, impaired humoral responses, a high frequency of infections and tumors, renal cysts, skin lesions, freezing behavior and sporadic bleeding. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts2 A G 11: 50,602,266 S35G probably benign Het
Adcy6 G T 15: 98,603,876 Q286K probably benign Het
Agrn A G 4: 156,176,532 S676P probably damaging Het
Arntl2 A G 6: 146,809,719 M74V probably benign Het
Arpp21 A T 9: 112,176,251 probably null Het
C1rb A T 6: 124,575,279 I319F possibly damaging Het
C2cd3 T C 7: 100,422,603 V629A Het
Cacna1i T G 15: 80,375,575 F1287C probably damaging Het
Catspere2 A G 1: 178,098,508 I247V probably benign Het
Cd101 C G 3: 101,018,729 A229P probably benign Het
Cdh23 T C 10: 60,305,116 D3151G probably damaging Het
Cenpc1 C A 5: 86,034,353 K557N possibly damaging Het
Col6a4 G A 9: 106,076,892 T416M possibly damaging Het
Cyp2c67 A T 19: 39,640,007 C164* probably null Het
Dopey2 A G 16: 93,747,508 E179G probably benign Het
Duoxa2 A T 2: 122,301,340 Y170F possibly damaging Het
Fras1 A G 5: 96,736,970 K2569R possibly damaging Het
Fsip2 C A 2: 82,983,118 H3260Q probably benign Het
Gm3402 T C 5: 146,515,233 I121T probably benign Het
Herc3 T A 6: 58,876,788 H606Q possibly damaging Het
Hmcn2 T C 2: 31,392,157 V1927A possibly damaging Het
Hnf4g A G 3: 3,652,864 H347R possibly damaging Het
Hs3st3a1 A G 11: 64,520,337 T234A probably benign Het
Hyal1 G T 9: 107,579,160 V379L probably benign Het
Ighv1-19 A G 12: 114,708,951 probably benign Het
Iqcc T A 4: 129,616,708 Q338L not run Het
Kdm5b T C 1: 134,560,439 V34A probably damaging Het
Lgals4 T C 7: 28,841,146 F225L probably benign Het
Lmtk3 C T 7: 45,795,157 T1088I unknown Het
Magel2 A T 7: 62,380,776 S1143C unknown Het
Mapk4 A T 18: 73,937,267 L185Q possibly damaging Het
Ncam1 A G 9: 49,506,911 S1030P Het
Nynrin A T 14: 55,863,914 T347S probably benign Het
Pak7 T C 2: 136,098,299 T532A probably damaging Het
Pcdhb15 A G 18: 37,474,336 E207G probably damaging Het
Pde6h T C 6: 136,963,213 W66R probably damaging Het
Pmaip1 T C 18: 66,458,814 probably null Het
Prkd3 A G 17: 78,954,566 F774S probably damaging Het
Prox1 T A 1: 190,161,845 R134S possibly damaging Het
Ptpn22 T A 3: 103,886,019 H495Q probably damaging Het
Ptprj G T 2: 90,440,782 Q1201K probably benign Het
Rp1l1 A G 14: 64,031,998 S1678G probably benign Het
Sez6l G T 5: 112,576,812 probably null Het
Sgcg T A 14: 61,240,367 Y91F probably damaging Het
Skint2 C T 4: 112,624,218 L93F probably damaging Het
Slc22a22 A T 15: 57,263,375 D99E probably benign Het
Slco3a1 A G 7: 74,284,342 I694T probably damaging Het
Smurf2 A T 11: 106,846,085 I305N possibly damaging Het
Soga1 T C 2: 157,031,005 Q862R possibly damaging Het
Stac3 T A 10: 127,504,900 V178D probably benign Het
Suclg2 T A 6: 95,566,460 N330I probably damaging Het
Suclg2 G A 6: 95,566,463 A329V probably damaging Het
Tas2r118 C T 6: 23,969,750 C104Y probably damaging Het
Trit1 T C 4: 123,016,779 M57T possibly damaging Het
Vav1 G A 17: 57,296,720 S134N probably benign Het
Vmn2r82 T C 10: 79,378,888 L235P probably damaging Het
Zfp735 T A 11: 73,711,553 V441E possibly damaging Het
Other mutations in Tom1l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00648:Tom1l2 APN 11 60261116 missense possibly damaging 0.93
IGL01459:Tom1l2 APN 11 60280269 missense probably damaging 1.00
IGL02990:Tom1l2 APN 11 60230236 missense probably damaging 1.00
R0025:Tom1l2 UTSW 11 60230134 missense probably damaging 0.96
R0025:Tom1l2 UTSW 11 60230134 missense probably damaging 0.96
R4456:Tom1l2 UTSW 11 60352815 unclassified probably benign
R4627:Tom1l2 UTSW 11 60242707 critical splice donor site probably null
R4695:Tom1l2 UTSW 11 60270433 missense probably damaging 0.98
R4713:Tom1l2 UTSW 11 60270433 missense probably damaging 0.98
R4731:Tom1l2 UTSW 11 60270433 missense probably damaging 0.98
R4788:Tom1l2 UTSW 11 60249018 missense probably damaging 1.00
R4937:Tom1l2 UTSW 11 60258918 missense probably damaging 1.00
R5320:Tom1l2 UTSW 11 60242822 nonsense probably null
R5367:Tom1l2 UTSW 11 60241808 missense probably benign 0.00
R6158:Tom1l2 UTSW 11 60232927 missense probably damaging 1.00
R6944:Tom1l2 UTSW 11 60248991 missense probably damaging 0.98
R7356:Tom1l2 UTSW 11 60249027 missense probably damaging 0.99
R7376:Tom1l2 UTSW 11 60261200 missense probably benign
R7544:Tom1l2 UTSW 11 60280214 small deletion probably benign
R7760:Tom1l2 UTSW 11 60274965 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTTCATGTGGACCACTGCAAAG -3'
(R):5'- TGAGTCCACAGTGAATCCTTAAG -3'

Sequencing Primer
(F):5'- ACTGCAAAGGCCTTCTCTGAC -3'
(R):5'- TCCACAGTGAATCCTTAAGGTAGG -3'
Posted On2019-09-13