Mutagenetix > Incidental Mutations

Incidental Mutation 'R7335:Rp1l1'

569453

Institutional Source

Beutler Lab

Gene Symbol

Rp1l1

Ensembl Gene

ENSMUSG00000046049

Gene Name

retinitis pigmentosa 1 homolog like 1

Synonyms

Dcdc4, Rp1hl1

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.087) question?

Stock #

R7335 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

63992506-64035025 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 64031998 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Glycine at position 1678 (S1678G)

Ref Sequence

ENSEMBL: ENSMUSP00000055449 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000058229]

Predicted Effect

probably benign
Transcript: ENSMUST00000058229
AA Change: S1678G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000055449
Gene: ENSMUSG00000046049
AA Change: S1678G

Domain	Start	End	E-Value	Type
low complexity region	11	21	N/A	INTRINSIC
DCX	37	121	1.58e-13	SMART
DCX	155	239	1e-15	SMART
low complexity region	709	728	N/A	INTRINSIC
low complexity region	870	884	N/A	INTRINSIC
low complexity region	1159	1177	N/A	INTRINSIC
low complexity region	1228	1239	N/A	INTRINSIC
low complexity region	1612	1618	N/A	INTRINSIC
low complexity region	1642	1652	N/A	INTRINSIC

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (56/56)

MGI Phenotype

FUNCTION: This gene encodes a member of the doublecortin family. This protein is a retinal-specific protein. It contains two N-terminal doublecortin domains, which can assemble and stabilize axonemal microtubules, but lacks the C-terminal repetitive regions including the 16aa repeat found in human RP1L1. This protein and the RP1 protein, another retinal-specific protein, play essential and synergistic roles in affecting photosensitivity and outer segment morphogenesis of rod photoreceptors. [provided by RefSeq, Sep 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit retinal photoreceptor abnormalities, including scattered outer segment disorganization, reduced electroretinogram amplitudes, and progressive retinal rod cell degeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts2	A	G	11: 50,602,266	S35G	probably benign	Het
Adcy6	G	T	15: 98,603,876	Q286K	probably benign	Het
Agrn	A	G	4: 156,176,532	S676P	probably damaging	Het
Arntl2	A	G	6: 146,809,719	M74V	probably benign	Het
Arpp21	A	T	9: 112,176,251		probably null	Het
C1rb	A	T	6: 124,575,279	I319F	possibly damaging	Het
C2cd3	T	C	7: 100,422,603	V629A		Het
Cacna1i	T	G	15: 80,375,575	F1287C	probably damaging	Het
Catspere2	A	G	1: 178,098,508	I247V	probably benign	Het
Cd101	C	G	3: 101,018,729	A229P	probably benign	Het
Cdh23	T	C	10: 60,305,116	D3151G	probably damaging	Het
Cenpc1	C	A	5: 86,034,353	K557N	possibly damaging	Het
Col6a4	G	A	9: 106,076,892	T416M	possibly damaging	Het
Cyp2c67	A	T	19: 39,640,007	C164*	probably null	Het
Dopey2	A	G	16: 93,747,508	E179G	probably benign	Het
Duoxa2	A	T	2: 122,301,340	Y170F	possibly damaging	Het
Fras1	A	G	5: 96,736,970	K2569R	possibly damaging	Het
Fsip2	C	A	2: 82,983,118	H3260Q	probably benign	Het
Gm3402	T	C	5: 146,515,233	I121T	probably benign	Het
Herc3	T	A	6: 58,876,788	H606Q	possibly damaging	Het
Hmcn2	T	C	2: 31,392,157	V1927A	possibly damaging	Het
Hnf4g	A	G	3: 3,652,864	H347R	possibly damaging	Het
Hs3st3a1	A	G	11: 64,520,337	T234A	probably benign	Het
Hyal1	G	T	9: 107,579,160	V379L	probably benign	Het
Ighv1-19	A	G	12: 114,708,951		probably benign	Het
Iqcc	T	A	4: 129,616,708	Q338L	not run	Het
Kdm5b	T	C	1: 134,560,439	V34A	probably damaging	Het
Lgals4	T	C	7: 28,841,146	F225L	probably benign	Het
Lmtk3	C	T	7: 45,795,157	T1088I	unknown	Het
Magel2	A	T	7: 62,380,776	S1143C	unknown	Het
Mapk4	A	T	18: 73,937,267	L185Q	possibly damaging	Het
Ncam1	A	G	9: 49,506,911	S1030P		Het
Nynrin	A	T	14: 55,863,914	T347S	probably benign	Het
Pak7	T	C	2: 136,098,299	T532A	probably damaging	Het
Pcdhb15	A	G	18: 37,474,336	E207G	probably damaging	Het
Pde6h	T	C	6: 136,963,213	W66R	probably damaging	Het
Pmaip1	T	C	18: 66,458,814		probably null	Het
Prkd3	A	G	17: 78,954,566	F774S	probably damaging	Het
Prox1	T	A	1: 190,161,845	R134S	possibly damaging	Het
Ptpn22	T	A	3: 103,886,019	H495Q	probably damaging	Het
Ptprj	G	T	2: 90,440,782	Q1201K	probably benign	Het
Sez6l	G	T	5: 112,576,812		probably null	Het
Sgcg	T	A	14: 61,240,367	Y91F	probably damaging	Het
Skint2	C	T	4: 112,624,218	L93F	probably damaging	Het
Slc22a22	A	T	15: 57,263,375	D99E	probably benign	Het
Slco3a1	A	G	7: 74,284,342	I694T	probably damaging	Het
Smurf2	A	T	11: 106,846,085	I305N	possibly damaging	Het
Soga1	T	C	2: 157,031,005	Q862R	possibly damaging	Het
Stac3	T	A	10: 127,504,900	V178D	probably benign	Het
Suclg2	T	A	6: 95,566,460	N330I	probably damaging	Het
Suclg2	G	A	6: 95,566,463	A329V	probably damaging	Het
Tas2r118	C	T	6: 23,969,750	C104Y	probably damaging	Het
Tom1l2	T	G	11: 60,245,165	E327D	probably benign	Het
Trit1	T	C	4: 123,016,779	M57T	possibly damaging	Het
Vav1	G	A	17: 57,296,720	S134N	probably benign	Het
Vmn2r82	T	C	10: 79,378,888	L235P	probably damaging	Het
Zfp735	T	A	11: 73,711,553	V441E	possibly damaging	Het

Other mutations in Rp1l1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00494:Rp1l1	APN	14	64028725	missense	probably benign	0.01
IGL02063:Rp1l1	APN	14	64029536	missense	probably damaging	0.99
IGL02132:Rp1l1	APN	14	64028810	missense	probably benign
IGL02430:Rp1l1	APN	14	64029286	missense	probably benign	0.00
IGL02977:Rp1l1	APN	14	64028150	missense	probably benign	0.01
IGL03213:Rp1l1	APN	14	64028415	missense	probably damaging	0.98
IGL03346:Rp1l1	APN	14	64029440	missense	probably benign
R0085:Rp1l1	UTSW	14	64022295	missense	probably damaging	0.99
R0347:Rp1l1	UTSW	14	64030804	nonsense	probably null
R0362:Rp1l1	UTSW	14	64031066	nonsense	probably null
R0369:Rp1l1	UTSW	14	64029388	missense	possibly damaging	0.84
R0538:Rp1l1	UTSW	14	64022092	missense	probably damaging	1.00
R0544:Rp1l1	UTSW	14	64032066	missense	probably benign	0.00
R0780:Rp1l1	UTSW	14	64030351	missense	possibly damaging	0.94
R0944:Rp1l1	UTSW	14	64032232	missense	probably benign	0.05
R1051:Rp1l1	UTSW	14	64032535	missense	probably damaging	0.99
R1126:Rp1l1	UTSW	14	64030469	missense	probably damaging	1.00
R1450:Rp1l1	UTSW	14	64028150	missense	probably benign	0.01
R1483:Rp1l1	UTSW	14	64029047	missense	possibly damaging	0.76
R1508:Rp1l1	UTSW	14	64030892	missense	possibly damaging	0.83
R1553:Rp1l1	UTSW	14	64031894	missense	probably benign	0.00
R1651:Rp1l1	UTSW	14	64030993	missense	probably damaging	0.97
R1682:Rp1l1	UTSW	14	64028968	missense	probably damaging	0.98
R1809:Rp1l1	UTSW	14	64027966	missense	probably benign	0.18
R1885:Rp1l1	UTSW	14	64028390	missense	probably benign	0.01
R1887:Rp1l1	UTSW	14	64028390	missense	probably benign	0.01
R1898:Rp1l1	UTSW	14	64031590	missense	probably benign	0.04
R1924:Rp1l1	UTSW	14	64031543	missense	probably benign
R1939:Rp1l1	UTSW	14	64029593	missense	probably benign
R1941:Rp1l1	UTSW	14	64022252	missense	probably damaging	1.00
R2129:Rp1l1	UTSW	14	64028966	missense	possibly damaging	0.93
R2363:Rp1l1	UTSW	14	64029998	missense	possibly damaging	0.55
R3894:Rp1l1	UTSW	14	64029307	missense	probably benign
R3974:Rp1l1	UTSW	14	64030309	missense	probably damaging	1.00
R3975:Rp1l1	UTSW	14	64030309	missense	probably damaging	1.00
R3976:Rp1l1	UTSW	14	64030309	missense	probably damaging	1.00
R4072:Rp1l1	UTSW	14	64028132	missense	probably damaging	1.00
R4672:Rp1l1	UTSW	14	64031270	missense	probably damaging	1.00
R4673:Rp1l1	UTSW	14	64031270	missense	probably damaging	1.00
R4749:Rp1l1	UTSW	14	64029800	missense	probably damaging	0.99
R4755:Rp1l1	UTSW	14	64030070	missense	probably benign	0.34
R4877:Rp1l1	UTSW	14	64026171	missense	probably benign	0.00
R4930:Rp1l1	UTSW	14	64032206	missense	probably benign
R5039:Rp1l1	UTSW	14	64031356	missense	probably benign	0.21
R5106:Rp1l1	UTSW	14	64027946	missense	probably damaging	1.00
R5184:Rp1l1	UTSW	14	64030180	missense	probably damaging	1.00
R5215:Rp1l1	UTSW	14	64030013	missense	probably benign	0.01
R5409:Rp1l1	UTSW	14	64030621	missense	probably benign	0.02
R5575:Rp1l1	UTSW	14	64030984	missense	probably benign	0.23
R5696:Rp1l1	UTSW	14	64029746	missense	probably damaging	0.99
R5739:Rp1l1	UTSW	14	64032170	missense	probably benign	0.01
R5878:Rp1l1	UTSW	14	64028906	missense	probably benign	0.09
R6133:Rp1l1	UTSW	14	64030096	missense	probably damaging	1.00
R6134:Rp1l1	UTSW	14	64030096	missense	probably damaging	1.00
R6135:Rp1l1	UTSW	14	64030096	missense	probably damaging	1.00
R6428:Rp1l1	UTSW	14	64032389	missense	possibly damaging	0.92
R6594:Rp1l1	UTSW	14	64031677	nonsense	probably null
R6736:Rp1l1	UTSW	14	64029724	missense	possibly damaging	0.93
R6800:Rp1l1	UTSW	14	64031150	missense	possibly damaging	0.92
R6848:Rp1l1	UTSW	14	64028218	missense	possibly damaging	0.79
R6878:Rp1l1	UTSW	14	64031852	missense	probably benign	0.00
R6922:Rp1l1	UTSW	14	64030385	missense	possibly damaging	0.93
R6980:Rp1l1	UTSW	14	64028720	missense	probably benign	0.02
R7053:Rp1l1	UTSW	14	64031509	missense	possibly damaging	0.68
R7151:Rp1l1	UTSW	14	64029026	missense	possibly damaging	0.73
R7291:Rp1l1	UTSW	14	64032298	missense	probably benign	0.10
R7344:Rp1l1	UTSW	14	64029620	missense	probably benign	0.00
R7470:Rp1l1	UTSW	14	64028566	missense	probably benign
R7570:Rp1l1	UTSW	14	64031574	nonsense	probably null
R7585:Rp1l1	UTSW	14	64030139	missense	probably damaging	0.96
R7591:Rp1l1	UTSW	14	64026109	missense	probably damaging	1.00
R7667:Rp1l1	UTSW	14	64029803	missense	probably benign	0.04
R7862:Rp1l1	UTSW	14	64028027	missense	probably damaging	1.00
R7935:Rp1l1	UTSW	14	64031225	missense	probably damaging	0.99
R8256:Rp1l1	UTSW	14	64028153	missense	probably benign	0.18
R8403:Rp1l1	UTSW	14	64028809	missense	probably benign	0.21
X0057:Rp1l1	UTSW	14	64030040	missense	probably benign	0.14
X0063:Rp1l1	UTSW	14	64029223	missense	probably damaging	0.98
Z1088:Rp1l1	UTSW	14	64028758	missense	possibly damaging	0.80
Z1088:Rp1l1	UTSW	14	64030378	missense	probably benign	0.01
Z1176:Rp1l1	UTSW	14	64029144	missense	probably damaging	1.00
Z1177:Rp1l1	UTSW	14	64032297	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- AACTGTCCAGGGAGCTGATG -3'
(R):5'- GGCTGGTGTTTTCAGAACCC -3'

Sequencing Primer
(F):5'- CTGTCCAGGGAGCTGATGAGAAG -3'
(R):5'- GGTGTTTTCAGAACCCACCCTTC -3'

Posted On

2019-09-13