Incidental Mutation 'R7335:Slc22a22'
ID569454
Institutional Source Beutler Lab
Gene Symbol Slc22a22
Ensembl Gene ENSMUSG00000022366
Gene Namesolute carrier family 22 (organic cation transporter), member 22
SynonymsBC026439, OAT-PG
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R7335 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location57243767-57477625 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 57263375 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 99 (D99E)
Ref Sequence ENSEMBL: ENSMUSP00000022995 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022995] [ENSMUST00000110196] [ENSMUST00000137764]
Predicted Effect probably benign
Transcript: ENSMUST00000022995
AA Change: D99E

PolyPhen 2 Score 0.185 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000022995
Gene: ENSMUSG00000022366
AA Change: D99E

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:MFS_1 117 483 1.2e-26 PFAM
Pfam:Sugar_tr 144 447 1.3e-20 PFAM
Pfam:Sugar_tr 393 553 3.2e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110196
AA Change: D99E

PolyPhen 2 Score 0.185 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000105825
Gene: ENSMUSG00000022366
AA Change: D99E

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:MFS_1 116 483 1.4e-26 PFAM
Pfam:Sugar_tr 145 426 1e-19 PFAM
Pfam:Sugar_tr 391 553 2.7e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137764
AA Change: D80E

PolyPhen 2 Score 0.185 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000123667
Gene: ENSMUSG00000022366
AA Change: D80E

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (56/56)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts2 A G 11: 50,602,266 S35G probably benign Het
Adcy6 G T 15: 98,603,876 Q286K probably benign Het
Agrn A G 4: 156,176,532 S676P probably damaging Het
Arntl2 A G 6: 146,809,719 M74V probably benign Het
Arpp21 A T 9: 112,176,251 probably null Het
C1rb A T 6: 124,575,279 I319F possibly damaging Het
C2cd3 T C 7: 100,422,603 V629A Het
Cacna1i T G 15: 80,375,575 F1287C probably damaging Het
Catspere2 A G 1: 178,098,508 I247V probably benign Het
Cd101 C G 3: 101,018,729 A229P probably benign Het
Cdh23 T C 10: 60,305,116 D3151G probably damaging Het
Cenpc1 C A 5: 86,034,353 K557N possibly damaging Het
Col6a4 G A 9: 106,076,892 T416M possibly damaging Het
Cyp2c67 A T 19: 39,640,007 C164* probably null Het
Dopey2 A G 16: 93,747,508 E179G probably benign Het
Duoxa2 A T 2: 122,301,340 Y170F possibly damaging Het
Fras1 A G 5: 96,736,970 K2569R possibly damaging Het
Fsip2 C A 2: 82,983,118 H3260Q probably benign Het
Gm3402 T C 5: 146,515,233 I121T probably benign Het
Herc3 T A 6: 58,876,788 H606Q possibly damaging Het
Hmcn2 T C 2: 31,392,157 V1927A possibly damaging Het
Hnf4g A G 3: 3,652,864 H347R possibly damaging Het
Hs3st3a1 A G 11: 64,520,337 T234A probably benign Het
Hyal1 G T 9: 107,579,160 V379L probably benign Het
Ighv1-19 A G 12: 114,708,951 probably benign Het
Iqcc T A 4: 129,616,708 Q338L not run Het
Kdm5b T C 1: 134,560,439 V34A probably damaging Het
Lgals4 T C 7: 28,841,146 F225L probably benign Het
Lmtk3 C T 7: 45,795,157 T1088I unknown Het
Magel2 A T 7: 62,380,776 S1143C unknown Het
Mapk4 A T 18: 73,937,267 L185Q possibly damaging Het
Ncam1 A G 9: 49,506,911 S1030P Het
Nynrin A T 14: 55,863,914 T347S probably benign Het
Pak7 T C 2: 136,098,299 T532A probably damaging Het
Pcdhb15 A G 18: 37,474,336 E207G probably damaging Het
Pde6h T C 6: 136,963,213 W66R probably damaging Het
Pmaip1 T C 18: 66,458,814 probably null Het
Prkd3 A G 17: 78,954,566 F774S probably damaging Het
Prox1 T A 1: 190,161,845 R134S possibly damaging Het
Ptpn22 T A 3: 103,886,019 H495Q probably damaging Het
Ptprj G T 2: 90,440,782 Q1201K probably benign Het
Rp1l1 A G 14: 64,031,998 S1678G probably benign Het
Sez6l G T 5: 112,576,812 probably null Het
Sgcg T A 14: 61,240,367 Y91F probably damaging Het
Skint2 C T 4: 112,624,218 L93F probably damaging Het
Slco3a1 A G 7: 74,284,342 I694T probably damaging Het
Smurf2 A T 11: 106,846,085 I305N possibly damaging Het
Soga1 T C 2: 157,031,005 Q862R possibly damaging Het
Stac3 T A 10: 127,504,900 V178D probably benign Het
Suclg2 T A 6: 95,566,460 N330I probably damaging Het
Suclg2 G A 6: 95,566,463 A329V probably damaging Het
Tas2r118 C T 6: 23,969,750 C104Y probably damaging Het
Tom1l2 T G 11: 60,245,165 E327D probably benign Het
Trit1 T C 4: 123,016,779 M57T possibly damaging Het
Vav1 G A 17: 57,296,720 S134N probably benign Het
Vmn2r82 T C 10: 79,378,888 L235P probably damaging Het
Zfp735 T A 11: 73,711,553 V441E possibly damaging Het
Other mutations in Slc22a22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01137:Slc22a22 APN 15 57254278 missense probably damaging 1.00
IGL01140:Slc22a22 APN 15 57263338 missense probably damaging 1.00
IGL02350:Slc22a22 APN 15 57247448 missense probably benign 0.16
IGL02357:Slc22a22 APN 15 57247448 missense probably benign 0.16
IGL03115:Slc22a22 APN 15 57263274 missense probably damaging 1.00
IGL03244:Slc22a22 APN 15 57249552 splice site probably benign
IGL03384:Slc22a22 APN 15 57254216 missense probably benign 0.01
R0371:Slc22a22 UTSW 15 57249735 missense possibly damaging 0.82
R0501:Slc22a22 UTSW 15 57249650 missense probably benign 0.16
R0684:Slc22a22 UTSW 15 57263362 missense probably benign 0.04
R0722:Slc22a22 UTSW 15 57256553 unclassified probably null
R1240:Slc22a22 UTSW 15 57250872 missense probably benign 0.02
R1472:Slc22a22 UTSW 15 57247520 missense probably benign 0.03
R2040:Slc22a22 UTSW 15 57247540 nonsense probably null
R2125:Slc22a22 UTSW 15 57254240 missense probably damaging 1.00
R3707:Slc22a22 UTSW 15 57250973 missense probably damaging 1.00
R3921:Slc22a22 UTSW 15 57256544 missense probably benign 0.07
R4184:Slc22a22 UTSW 15 57256566 nonsense probably null
R4561:Slc22a22 UTSW 15 57263385 missense probably damaging 1.00
R4626:Slc22a22 UTSW 15 57263338 missense probably damaging 1.00
R4887:Slc22a22 UTSW 15 57249752 missense probably benign 0.20
R5181:Slc22a22 UTSW 15 57255123 missense probably benign 0.08
R5486:Slc22a22 UTSW 15 57263451 missense probably damaging 0.97
R5621:Slc22a22 UTSW 15 57259151 missense probably benign 0.02
R5812:Slc22a22 UTSW 15 57256473 critical splice donor site probably null
R5958:Slc22a22 UTSW 15 57263536 missense possibly damaging 0.95
R6517:Slc22a22 UTSW 15 57250969 missense probably benign 0.28
R6555:Slc22a22 UTSW 15 57259131 missense probably benign 0.08
R6724:Slc22a22 UTSW 15 57247532 missense probably damaging 1.00
R6744:Slc22a22 UTSW 15 57254272 missense possibly damaging 0.46
R7078:Slc22a22 UTSW 15 57263480 missense probably benign 0.01
R7085:Slc22a22 UTSW 15 57249649 missense probably benign 0.00
R7263:Slc22a22 UTSW 15 57249711 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGTTAAACCTTTTGTAGACTGGTGG -3'
(R):5'- TTTACAGCAGCCATCCCTG -3'

Sequencing Primer
(F):5'- AACCTTTTGTAGACTGGTGGTATTAC -3'
(R):5'- CCCTGCTCATCACTGTAGTATAAAC -3'
Posted On2019-09-13