Mutagenetix > Incidental Mutations

Incidental Mutation 'R7335:Vav1'

569458

Institutional Source

Beutler Lab

Gene Symbol

Vav1

Ensembl Gene

ENSMUSG00000034116

Gene Name

vav 1 oncogene

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.290) question?

Stock #

R7335 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

57279100-57328031 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 57296720 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Asparagine at position 134 (S134N)

Ref Sequence

ENSEMBL: ENSMUSP00000005889 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000005889] [ENSMUST00000112870] [ENSMUST00000169220]

PDB Structure

NMR STRUCTURE OF THE Y174 AUTOINHIBITED DBL HOMOLOGY DOMAIN [SOLUTION NMR]
CRYSTAL STRUCTURE OF VAV SH3 DOMAIN [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF VAV AND GRB2 SH3 DOMAINS [X-RAY DIFFRACTION]
Solution structure of N-terminal SH3 domain mutant(P33G) of murine Vav [SOLUTION NMR]
Attachment of an NMR-invisible solubility enhancement tag (INSET) using a sortase-mediated protein ligation method [SOLUTION NMR]
CRITICAL STRUCTURAL ROLE FOR THE PH AND C1 DOMAINS OF THE VAV1 EXCHANGE FACTOR [X-RAY DIFFRACTION]

Predicted Effect

probably benign
Transcript: ENSMUST00000005889
AA Change: S134N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000005889
Gene: ENSMUSG00000034116
AA Change: S134N

Domain	Start	End	E-Value	Type
CH	3	115	5.69e-15	SMART
RhoGEF	198	372	7.89e-62	SMART
PH	403	506	8.45e-12	SMART
C1	516	564	3.67e-9	SMART
SH3	595	659	1.65e-8	SMART
SH2	669	751	8.88e-25	SMART
SH3	785	841	1.44e-22	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000112870
AA Change: S134N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000108491
Gene: ENSMUSG00000034116
AA Change: S134N

Domain	Start	End	E-Value	Type
CH	3	115	5.69e-15	SMART
RhoGEF	198	372	7.89e-62	SMART
PH	403	506	8.45e-12	SMART
C1	516	564	3.67e-9	SMART
SH3	595	659	1.65e-8	SMART
SH2	633	712	3.93e-2	SMART
SH3	746	802	1.44e-22	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000169220
AA Change: S110N

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000126694
Gene: ENSMUSG00000034116
AA Change: S110N

Domain	Start	End	E-Value	Type
Pfam:CAMSAP_CH	27	79	6.2e-11	PFAM
RhoGEF	174	348	7.89e-62	SMART
PH	379	482	8.45e-12	SMART
C1	492	540	3.67e-9	SMART
SH3	571	635	1.65e-8	SMART
SH2	645	727	8.88e-25	SMART
SH3	761	817	1.44e-22	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (56/56)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the VAV gene family. The VAV proteins are guanine nucleotide exchange factors (GEFs) for Rho family GTPases that activate pathways leading to actin cytoskeletal rearrangements and transcriptional alterations. The encoded protein is important in hematopoiesis, playing a role in T-cell and B-cell development and activation. The encoded protein has been identified as the specific binding partner of Nef proteins from HIV-1. Coexpression and binding of these partners initiates profound morphological changes, cytoskeletal rearrangements and the JNK/SAPK signaling cascade, leading to increased levels of viral transcription and replication. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Homozygous null mutants exhibit defective T cell maturation, interleukin-2 production, and cell cycle progression. Immunoglobulin class switching is also impaired and attributed to defective T cell help. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts2	A	G	11: 50,602,266	S35G	probably benign	Het
Adcy6	G	T	15: 98,603,876	Q286K	probably benign	Het
Agrn	A	G	4: 156,176,532	S676P	probably damaging	Het
Arntl2	A	G	6: 146,809,719	M74V	probably benign	Het
Arpp21	A	T	9: 112,176,251		probably null	Het
C1rb	A	T	6: 124,575,279	I319F	possibly damaging	Het
C2cd3	T	C	7: 100,422,603	V629A		Het
Cacna1i	T	G	15: 80,375,575	F1287C	probably damaging	Het
Catspere2	A	G	1: 178,098,508	I247V	probably benign	Het
Cd101	C	G	3: 101,018,729	A229P	probably benign	Het
Cdh23	T	C	10: 60,305,116	D3151G	probably damaging	Het
Cenpc1	C	A	5: 86,034,353	K557N	possibly damaging	Het
Col6a4	G	A	9: 106,076,892	T416M	possibly damaging	Het
Cyp2c67	A	T	19: 39,640,007	C164*	probably null	Het
Dopey2	A	G	16: 93,747,508	E179G	probably benign	Het
Duoxa2	A	T	2: 122,301,340	Y170F	possibly damaging	Het
Fras1	A	G	5: 96,736,970	K2569R	possibly damaging	Het
Fsip2	C	A	2: 82,983,118	H3260Q	probably benign	Het
Gm3402	T	C	5: 146,515,233	I121T	probably benign	Het
Herc3	T	A	6: 58,876,788	H606Q	possibly damaging	Het
Hmcn2	T	C	2: 31,392,157	V1927A	possibly damaging	Het
Hnf4g	A	G	3: 3,652,864	H347R	possibly damaging	Het
Hs3st3a1	A	G	11: 64,520,337	T234A	probably benign	Het
Hyal1	G	T	9: 107,579,160	V379L	probably benign	Het
Ighv1-19	A	G	12: 114,708,951		probably benign	Het
Iqcc	T	A	4: 129,616,708	Q338L	not run	Het
Kdm5b	T	C	1: 134,560,439	V34A	probably damaging	Het
Lgals4	T	C	7: 28,841,146	F225L	probably benign	Het
Lmtk3	C	T	7: 45,795,157	T1088I	unknown	Het
Magel2	A	T	7: 62,380,776	S1143C	unknown	Het
Mapk4	A	T	18: 73,937,267	L185Q	possibly damaging	Het
Ncam1	A	G	9: 49,506,911	S1030P		Het
Nynrin	A	T	14: 55,863,914	T347S	probably benign	Het
Pak7	T	C	2: 136,098,299	T532A	probably damaging	Het
Pcdhb15	A	G	18: 37,474,336	E207G	probably damaging	Het
Pde6h	T	C	6: 136,963,213	W66R	probably damaging	Het
Pmaip1	T	C	18: 66,458,814		probably null	Het
Prkd3	A	G	17: 78,954,566	F774S	probably damaging	Het
Prox1	T	A	1: 190,161,845	R134S	possibly damaging	Het
Ptpn22	T	A	3: 103,886,019	H495Q	probably damaging	Het
Ptprj	G	T	2: 90,440,782	Q1201K	probably benign	Het
Rp1l1	A	G	14: 64,031,998	S1678G	probably benign	Het
Sez6l	G	T	5: 112,576,812		probably null	Het
Sgcg	T	A	14: 61,240,367	Y91F	probably damaging	Het
Skint2	C	T	4: 112,624,218	L93F	probably damaging	Het
Slc22a22	A	T	15: 57,263,375	D99E	probably benign	Het
Slco3a1	A	G	7: 74,284,342	I694T	probably damaging	Het
Smurf2	A	T	11: 106,846,085	I305N	possibly damaging	Het
Soga1	T	C	2: 157,031,005	Q862R	possibly damaging	Het
Stac3	T	A	10: 127,504,900	V178D	probably benign	Het
Suclg2	T	A	6: 95,566,460	N330I	probably damaging	Het
Suclg2	G	A	6: 95,566,463	A329V	probably damaging	Het
Tas2r118	C	T	6: 23,969,750	C104Y	probably damaging	Het
Tom1l2	T	G	11: 60,245,165	E327D	probably benign	Het
Trit1	T	C	4: 123,016,779	M57T	possibly damaging	Het
Vmn2r82	T	C	10: 79,378,888	L235P	probably damaging	Het
Zfp735	T	A	11: 73,711,553	V441E	possibly damaging	Het

Other mutations in Vav1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01071:Vav1	APN	17	57299176	missense	probably benign	0.21
IGL01613:Vav1	APN	17	57307067	missense	possibly damaging	0.93
IGL02032:Vav1	APN	17	57297090	missense	possibly damaging	0.91
IGL02213:Vav1	APN	17	57305351	missense	possibly damaging	0.84
IGL03009:Vav1	APN	17	57296582	missense	probably benign	0.38
Belated	UTSW	17	57301214	missense	probably benign	0.06
Delayed	UTSW	17	57296552	missense	probably damaging	1.00
finally	UTSW	17	57311860	nonsense	probably null
Last	UTSW	17	57296039	missense	probably damaging	0.99
Late	UTSW	17	57301870	missense	possibly damaging	0.91
Plain_sight	UTSW	17	57297122	missense	probably damaging	1.00
tardive	UTSW	17	57303079	nonsense	probably null
R0116:Vav1	UTSW	17	57296039	missense	probably damaging	0.99
R0125:Vav1	UTSW	17	57299847	missense	probably damaging	1.00
R0268:Vav1	UTSW	17	57296090	missense	probably damaging	1.00
R0344:Vav1	UTSW	17	57296090	missense	probably damaging	1.00
R0579:Vav1	UTSW	17	57279271	missense	probably benign	0.01
R0634:Vav1	UTSW	17	57303862	missense	probably benign	0.00
R1313:Vav1	UTSW	17	57309498	splice site	probably benign
R1345:Vav1	UTSW	17	57301214	missense	probably benign	0.06
R1402:Vav1	UTSW	17	57303849	missense	probably benign	0.18
R1402:Vav1	UTSW	17	57303849	missense	probably benign	0.18
R1579:Vav1	UTSW	17	57297252	missense	probably benign	0.05
R1872:Vav1	UTSW	17	57324750	missense	probably damaging	1.00
R1971:Vav1	UTSW	17	57327697	missense	probably damaging	1.00
R2197:Vav1	UTSW	17	57303140	missense	probably benign	0.37
R2903:Vav1	UTSW	17	57306187	missense	probably benign	0.05
R4623:Vav1	UTSW	17	57299839	splice site	probably null
R4753:Vav1	UTSW	17	57306140	missense	probably damaging	0.98
R4779:Vav1	UTSW	17	57296552	missense	probably damaging	1.00
R5232:Vav1	UTSW	17	57303846	missense	possibly damaging	0.81
R5240:Vav1	UTSW	17	57297122	missense	probably damaging	1.00
R5503:Vav1	UTSW	17	57303079	nonsense	probably null
R5592:Vav1	UTSW	17	57304835	missense	probably benign	0.00
R5782:Vav1	UTSW	17	57296001	missense	probably damaging	1.00
R5945:Vav1	UTSW	17	57301870	missense	possibly damaging	0.91
R6113:Vav1	UTSW	17	57301884	missense	probably benign	0.00
R6514:Vav1	UTSW	17	57327660	missense	probably damaging	1.00
R6575:Vav1	UTSW	17	57305280	missense	probably damaging	0.97
R6932:Vav1	UTSW	17	57302330	missense	possibly damaging	0.92
R7024:Vav1	UTSW	17	57279268	missense	probably damaging	1.00
R7063:Vav1	UTSW	17	57311860	nonsense	probably null
R7322:Vav1	UTSW	17	57302266	missense	probably benign
R7474:Vav1	UTSW	17	57299102	missense	probably benign	0.07
R7665:Vav1	UTSW	17	57297086	missense	probably damaging	1.00
Z1176:Vav1	UTSW	17	57303853	missense	not run
Z1177:Vav1	UTSW	17	57303040	missense	not run

Predicted Primers

PCR Primer
(F):5'- GGTCATCTACACCCTGTCTG -3'
(R):5'- CACGTCTTGCAATGTGTCAC -3'

Sequencing Primer
(F):5'- GTCTGCTCTGTCATGGACAC -3'
(R):5'- GCAATGTGTCACCTTAAACTACAGG -3'

Posted On

2019-09-13