Incidental Mutation 'R7335:Prkd3'
ID569459
Institutional Source Beutler Lab
Gene Symbol Prkd3
Ensembl Gene ENSMUSG00000024070
Gene Nameprotein kinase D3
SynonymsPrkcn, 5730497N19Rik, PKD3, 4930557O20Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.177) question?
Stock #R7335 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location78949405-79020816 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 78954566 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 774 (F774S)
Ref Sequence ENSEMBL: ENSMUSP00000113395 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003191] [ENSMUST00000118768] [ENSMUST00000119284] [ENSMUST00000168887]
Predicted Effect probably damaging
Transcript: ENSMUST00000003191
AA Change: F773S

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000003191
Gene: ENSMUSG00000024070
AA Change: F773S

DomainStartEndE-ValueType
C1 155 204 1.95e-13 SMART
C1 272 321 1.26e-16 SMART
PH 417 534 1.18e-10 SMART
S_TKc 575 831 4.5e-90 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000118768
AA Change: F679S

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000113232
Gene: ENSMUSG00000024070
AA Change: F679S

DomainStartEndE-ValueType
C1 60 109 1.95e-13 SMART
C1 177 226 1.26e-16 SMART
PH 322 439 1.18e-10 SMART
S_TKc 481 737 4.5e-90 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000119284
AA Change: F774S

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000113395
Gene: ENSMUSG00000024070
AA Change: F774S

DomainStartEndE-ValueType
C1 155 204 1.95e-13 SMART
C1 272 321 1.26e-16 SMART
PH 417 534 1.18e-10 SMART
S_TKc 576 832 4.5e-90 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000168887
AA Change: F773S

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000132004
Gene: ENSMUSG00000024070
AA Change: F773S

DomainStartEndE-ValueType
C1 155 204 1.95e-13 SMART
C1 272 321 1.26e-16 SMART
PH 417 534 1.18e-10 SMART
S_TKc 575 831 4.5e-90 SMART
Meta Mutation Damage Score 0.6472 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the multigene protein kinase D family of serine/threonine kinases, which bind diacylglycerol and phorbol esters. Members of this family are characterized by an N-terminal regulatory domain comprised of a tandem repeat of cysteine-rich zinc-finger motifs and a pleckstrin domain. The C-terminal region contains the catalytic domain and is distantly related to calcium-regulated kinases. Catalytic activity of this enzyme promotes its nuclear localization. This protein has been implicated in a variety of functions including negative regulation of human airway epithelial barrier formation, growth regulation of breast and prostate cancer cells, and vesicle trafficking. [provided by RefSeq, Jan 2015]
PHENOTYPE: Homozygous mutation of this gene results in abnormal vertebral trabecular bone morphology and abnormal femur morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts2 A G 11: 50,602,266 S35G probably benign Het
Adcy6 G T 15: 98,603,876 Q286K probably benign Het
Agrn A G 4: 156,176,532 S676P probably damaging Het
Arntl2 A G 6: 146,809,719 M74V probably benign Het
Arpp21 A T 9: 112,176,251 probably null Het
C1rb A T 6: 124,575,279 I319F possibly damaging Het
C2cd3 T C 7: 100,422,603 V629A Het
Cacna1i T G 15: 80,375,575 F1287C probably damaging Het
Catspere2 A G 1: 178,098,508 I247V probably benign Het
Cd101 C G 3: 101,018,729 A229P probably benign Het
Cdh23 T C 10: 60,305,116 D3151G probably damaging Het
Cenpc1 C A 5: 86,034,353 K557N possibly damaging Het
Col6a4 G A 9: 106,076,892 T416M possibly damaging Het
Cyp2c67 A T 19: 39,640,007 C164* probably null Het
Dopey2 A G 16: 93,747,508 E179G probably benign Het
Duoxa2 A T 2: 122,301,340 Y170F possibly damaging Het
Fras1 A G 5: 96,736,970 K2569R possibly damaging Het
Fsip2 C A 2: 82,983,118 H3260Q probably benign Het
Gm3402 T C 5: 146,515,233 I121T probably benign Het
Herc3 T A 6: 58,876,788 H606Q possibly damaging Het
Hmcn2 T C 2: 31,392,157 V1927A possibly damaging Het
Hnf4g A G 3: 3,652,864 H347R possibly damaging Het
Hs3st3a1 A G 11: 64,520,337 T234A probably benign Het
Hyal1 G T 9: 107,579,160 V379L probably benign Het
Ighv1-19 A G 12: 114,708,951 probably benign Het
Iqcc T A 4: 129,616,708 Q338L not run Het
Kdm5b T C 1: 134,560,439 V34A probably damaging Het
Lgals4 T C 7: 28,841,146 F225L probably benign Het
Lmtk3 C T 7: 45,795,157 T1088I unknown Het
Magel2 A T 7: 62,380,776 S1143C unknown Het
Mapk4 A T 18: 73,937,267 L185Q possibly damaging Het
Ncam1 A G 9: 49,506,911 S1030P Het
Nynrin A T 14: 55,863,914 T347S probably benign Het
Pak7 T C 2: 136,098,299 T532A probably damaging Het
Pcdhb15 A G 18: 37,474,336 E207G probably damaging Het
Pde6h T C 6: 136,963,213 W66R probably damaging Het
Pmaip1 T C 18: 66,458,814 probably null Het
Prox1 T A 1: 190,161,845 R134S possibly damaging Het
Ptpn22 T A 3: 103,886,019 H495Q probably damaging Het
Ptprj G T 2: 90,440,782 Q1201K probably benign Het
Rp1l1 A G 14: 64,031,998 S1678G probably benign Het
Sez6l G T 5: 112,576,812 probably null Het
Sgcg T A 14: 61,240,367 Y91F probably damaging Het
Skint2 C T 4: 112,624,218 L93F probably damaging Het
Slc22a22 A T 15: 57,263,375 D99E probably benign Het
Slco3a1 A G 7: 74,284,342 I694T probably damaging Het
Smurf2 A T 11: 106,846,085 I305N possibly damaging Het
Soga1 T C 2: 157,031,005 Q862R possibly damaging Het
Stac3 T A 10: 127,504,900 V178D probably benign Het
Suclg2 T A 6: 95,566,460 N330I probably damaging Het
Suclg2 G A 6: 95,566,463 A329V probably damaging Het
Tas2r118 C T 6: 23,969,750 C104Y probably damaging Het
Tom1l2 T G 11: 60,245,165 E327D probably benign Het
Trit1 T C 4: 123,016,779 M57T possibly damaging Het
Vav1 G A 17: 57,296,720 S134N probably benign Het
Vmn2r82 T C 10: 79,378,888 L235P probably damaging Het
Zfp735 T A 11: 73,711,553 V441E possibly damaging Het
Other mutations in Prkd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Prkd3 APN 17 78954523 missense probably benign 0.00
IGL01775:Prkd3 APN 17 79012760 missense probably damaging 1.00
IGL01875:Prkd3 APN 17 78957206 missense possibly damaging 0.95
IGL01892:Prkd3 APN 17 78972501 missense probably benign 0.13
FR4304:Prkd3 UTSW 17 78975820 intron probably null
R0070:Prkd3 UTSW 17 78954510 missense probably damaging 1.00
R0070:Prkd3 UTSW 17 78954510 missense probably damaging 1.00
R0374:Prkd3 UTSW 17 78957215 missense probably null 1.00
R0688:Prkd3 UTSW 17 78957233 missense probably damaging 0.99
R1112:Prkd3 UTSW 17 78966408 missense probably damaging 1.00
R1364:Prkd3 UTSW 17 78957258 missense probably damaging 1.00
R1382:Prkd3 UTSW 17 78957245 missense probably damaging 1.00
R1459:Prkd3 UTSW 17 78971367 missense probably damaging 1.00
R1522:Prkd3 UTSW 17 78952696 missense probably damaging 1.00
R1645:Prkd3 UTSW 17 78956520 critical splice donor site probably null
R2035:Prkd3 UTSW 17 78975373 critical splice donor site probably null
R2187:Prkd3 UTSW 17 78975554 missense probably benign
R2250:Prkd3 UTSW 17 78968078 missense probably benign 0.15
R2850:Prkd3 UTSW 17 78954596 missense possibly damaging 0.89
R3625:Prkd3 UTSW 17 78985304 missense probably damaging 1.00
R3773:Prkd3 UTSW 17 78959106 missense possibly damaging 0.52
R3973:Prkd3 UTSW 17 78959141 splice site probably benign
R4089:Prkd3 UTSW 17 78971388 missense possibly damaging 0.64
R4407:Prkd3 UTSW 17 78983558 missense probably damaging 1.00
R4453:Prkd3 UTSW 17 78983546 missense probably damaging 1.00
R4697:Prkd3 UTSW 17 78961171 missense probably benign 0.02
R4715:Prkd3 UTSW 17 78951937 missense possibly damaging 0.73
R4754:Prkd3 UTSW 17 78956614 missense probably damaging 1.00
R4955:Prkd3 UTSW 17 78952727 missense probably null 0.95
R5412:Prkd3 UTSW 17 78954711 missense possibly damaging 0.85
R6163:Prkd3 UTSW 17 78966355 missense possibly damaging 0.94
R6280:Prkd3 UTSW 17 78981931 missense probably damaging 0.97
R7074:Prkd3 UTSW 17 78974807 nonsense probably null
R7153:Prkd3 UTSW 17 78966355 missense probably benign 0.04
R7492:Prkd3 UTSW 17 78962545 nonsense probably null
X0063:Prkd3 UTSW 17 78956613 missense probably damaging 1.00
X0066:Prkd3 UTSW 17 78961182 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGACTGGTACTGACTCAGGGAG -3'
(R):5'- CACTGAGCATAGCTAGGGACAG -3'

Sequencing Primer
(F):5'- CTGGTACTGACTCAGGGAGATGAAG -3'
(R):5'- CAATTTCCAGGTGAAGCTGTGTGAC -3'
Posted On2019-09-13