Incidental Mutation 'R7336:Dnah14'
ID569468
Institutional Source Beutler Lab
Gene Symbol Dnah14
Ensembl Gene ENSMUSG00000047369
Gene Namedynein, axonemal, heavy chain 14
SynonymsDnahc14, Gm980, LOC381311, A230079K17Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R7336 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location181576559-181815774 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 181797734 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 4060 (D4060G)
Ref Sequence ENSEMBL: ENSMUSP00000146843 (fasta)
Predicted Effect probably damaging
Transcript: ENSMUST00000208001
AA Change: D4060G

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dyneins are microtubule-associated motor protein complexes composed of several heavy, light, and intermediate chains. Two major classes of dyneins, axonemal and cytoplasmic, have been identified. DNAH14 is an axonemal dynein heavy chain (DHC) (Vaughan et al., 1996 [PubMed 8812413]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 A T 7: 120,388,233 Q1247H possibly damaging Het
Acsf2 G C 11: 94,571,650 Q180E probably benign Het
Adamts8 A G 9: 30,962,067 D856G probably benign Het
Agrn A T 4: 156,174,914 C828* probably null Het
Ankub1 T C 3: 57,665,687 T205A probably benign Het
Atm A T 9: 53,462,503 Y2150N possibly damaging Het
Barhl1 A G 2: 28,909,843 F257L probably benign Het
Bcat2 T A 7: 45,575,485 C27S probably benign Het
Bod1l G A 5: 41,821,524 R816C probably damaging Het
Btg3 A G 16: 78,364,807 Y172H probably benign Het
C130079G13Rik G A 3: 59,932,753 probably null Het
Cacna1d T C 14: 30,045,282 D1940G probably benign Het
Catsperg2 T A 7: 29,706,601 N624I possibly damaging Het
Ccdc146 A G 5: 21,303,112 V646A probably benign Het
Ccp110 C T 7: 118,722,210 P363S probably damaging Het
Cct4 C A 11: 23,001,564 T377K possibly damaging Het
Cep350 T A 1: 155,862,276 H2607L probably benign Het
Cfap46 A G 7: 139,620,104 F1954L unknown Het
Chat C T 14: 32,423,256 probably null Het
Clasp2 A G 9: 113,876,353 probably null Het
Cldn9 T C 17: 23,683,015 D212G probably benign Het
Cp G A 3: 19,964,532 probably null Het
Cyfip1 T A 7: 55,926,400 I1108N possibly damaging Het
Dpyd A G 3: 119,064,921 T595A probably damaging Het
Eps8 G A 6: 137,509,213 R434C possibly damaging Het
Fasl A G 1: 161,787,988 Y100H probably damaging Het
Fkbp9 A T 6: 56,849,727 N104I probably damaging Het
Frmd4a A G 2: 4,473,214 T65A possibly damaging Het
Gm1110 T C 9: 26,914,357 N102S probably damaging Het
Gm2381 T C 7: 42,822,380 Q25R possibly damaging Het
Gtpbp2 A G 17: 46,161,313 Y58C probably damaging Het
H2-T3 C A 17: 36,187,345 K269N probably damaging Het
Icosl C A 10: 78,073,873 Y217* probably null Het
Il17rd G T 14: 27,087,546 R153L probably benign Het
Kif17 C A 4: 138,298,306 T973K possibly damaging Het
Klk1b16 A G 7: 44,141,483 I236M probably benign Het
Lgmn G A 12: 102,423,739 probably benign Het
Lmbr1l T C 15: 98,913,587 D54G possibly damaging Het
Lrrc49 A T 9: 60,677,191 I196N possibly damaging Het
Maml1 C T 11: 50,266,449 A300T possibly damaging Het
Mapkap1 A T 2: 34,533,817 Q293L possibly damaging Het
Mki67 T C 7: 135,713,839 T69A probably benign Het
Mlph G A 1: 90,921,983 probably null Het
Myh1 A T 11: 67,220,609 M1625L probably benign Het
Myh3 G T 11: 67,091,021 R781L probably benign Het
Nckap5 A T 1: 126,026,049 I922K probably benign Het
Nlrp5 T A 7: 23,417,634 M261K probably damaging Het
Olfr1317 A T 2: 112,142,169 S75C possibly damaging Het
Olfr312 T A 11: 58,831,924 Y257N probably damaging Het
Olfr396-ps1 G A 11: 73,928,837 M204I probably benign Het
Olfr965 A G 9: 39,719,610 N128D probably benign Het
Pak1 T A 7: 97,888,972 V262E probably benign Het
Pigw A T 11: 84,877,104 D466E probably damaging Het
Pira2 A T 7: 3,844,345 L115Q probably damaging Het
Rbm15 A C 3: 107,333,116 probably benign Het
Rfx1 A G 8: 84,073,756 probably benign Het
Rfx7 A G 9: 72,593,357 Y133C probably damaging Het
Serpinb9d T A 13: 33,200,719 D226E probably benign Het
Sgk3 G A 1: 9,884,476 A271T possibly damaging Het
Sh2d5 T A 4: 138,256,839 C173S probably benign Het
Skint8 T C 4: 111,939,572 V291A probably benign Het
Slc22a27 T A 19: 7,926,689 N28Y probably benign Het
Slc25a54 G A 3: 109,116,435 V449I probably benign Het
Slc39a9 T C 12: 80,679,542 F255S probably damaging Het
Spata31d1c C T 13: 65,036,128 H495Y probably damaging Het
Stab2 G A 10: 86,969,185 Q310* probably null Het
Supt16 C A 14: 52,171,491 A809S possibly damaging Het
Tenm3 A T 8: 48,236,177 M2125K possibly damaging Het
Tex2 G A 11: 106,548,859 T565M unknown Het
Tll1 G A 8: 64,025,142 A859V probably damaging Het
Tmem106c C T 15: 97,969,631 T232I possibly damaging Het
Tmem2 C A 19: 21,826,145 Y847* probably null Het
Trim65 T G 11: 116,128,290 D141A probably benign Het
Trim80 T C 11: 115,441,216 F78S probably damaging Het
Txnrd1 T A 10: 82,873,217 I83N probably benign Het
Vnn3 G A 10: 23,851,908 G72D probably benign Het
Wasl G T 6: 24,619,687 P278Q unknown Het
Wdr62 A T 7: 30,243,917 L951Q probably damaging Het
Zfp760 C T 17: 21,723,833 T663I unknown Het
Other mutations in Dnah14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01086:Dnah14 APN 1 181752046 missense probably benign 0.17
IGL01764:Dnah14 APN 1 181744777 missense probably benign 0.00
IGL03218:Dnah14 APN 1 181755269 missense probably benign 0.02
IGL03290:Dnah14 APN 1 181763978 splice site probably benign
IGL03384:Dnah14 APN 1 181745949 missense probably benign 0.03
R0009:Dnah14 UTSW 1 181769407 splice site probably benign
R0125:Dnah14 UTSW 1 181752063 missense probably damaging 0.99
R0579:Dnah14 UTSW 1 181744747 missense possibly damaging 0.72
R0973:Dnah14 UTSW 1 181752145 missense probably damaging 1.00
R0973:Dnah14 UTSW 1 181752145 missense probably damaging 1.00
R0974:Dnah14 UTSW 1 181752145 missense probably damaging 1.00
R1609:Dnah14 UTSW 1 181750177 missense probably damaging 0.97
R1860:Dnah14 UTSW 1 181763960 missense probably damaging 1.00
R2050:Dnah14 UTSW 1 181752562 missense probably damaging 1.00
R2974:Dnah14 UTSW 1 181755241 critical splice acceptor site probably null
R4715:Dnah14 UTSW 1 181757223 missense probably damaging 1.00
R5076:Dnah14 UTSW 1 181757234 missense probably benign 0.01
R5424:Dnah14 UTSW 1 181763310 missense possibly damaging 0.95
R5808:Dnah14 UTSW 1 181741159 missense possibly damaging 0.72
R5997:Dnah14 UTSW 1 181770105 missense probably benign 0.00
R6052:Dnah14 UTSW 1 181666487 missense possibly damaging 0.50
R6061:Dnah14 UTSW 1 181709051 missense probably damaging 1.00
R6089:Dnah14 UTSW 1 181750154 missense probably damaging 1.00
R6092:Dnah14 UTSW 1 181621833 missense probably benign 0.13
R6145:Dnah14 UTSW 1 181666417 missense probably benign 0.00
R6163:Dnah14 UTSW 1 181666361 missense probably benign 0.33
R6246:Dnah14 UTSW 1 181680888 missense probably benign 0.00
R6302:Dnah14 UTSW 1 181601206 missense possibly damaging 0.96
R6306:Dnah14 UTSW 1 181585024 frame shift probably null
R6326:Dnah14 UTSW 1 181783556 missense probably damaging 1.00
R6348:Dnah14 UTSW 1 181626720 missense possibly damaging 0.83
R6367:Dnah14 UTSW 1 181755386 splice site probably null
R6376:Dnah14 UTSW 1 181605894 missense possibly damaging 0.79
R6389:Dnah14 UTSW 1 181651202 critical splice donor site probably null
R6433:Dnah14 UTSW 1 181651657 missense probably damaging 0.99
R6454:Dnah14 UTSW 1 181783705 missense probably damaging 1.00
R6476:Dnah14 UTSW 1 181744768 missense probably benign 0.26
R6523:Dnah14 UTSW 1 181643621 missense probably benign 0.00
R6529:Dnah14 UTSW 1 181666469 missense probably damaging 0.98
R6538:Dnah14 UTSW 1 181584985 missense unknown
R6546:Dnah14 UTSW 1 181738987 missense probably damaging 1.00
R6752:Dnah14 UTSW 1 181593452 missense probably benign 0.07
R6762:Dnah14 UTSW 1 181757259 missense probably damaging 1.00
R6786:Dnah14 UTSW 1 181641405 missense probably benign 0.21
R6849:Dnah14 UTSW 1 181808945 missense probably benign 0.00
R6877:Dnah14 UTSW 1 181628432 missense possibly damaging 0.82
R6912:Dnah14 UTSW 1 181750183 missense possibly damaging 0.83
R6919:Dnah14 UTSW 1 181585066 missense probably benign 0.04
R6924:Dnah14 UTSW 1 181627952 missense probably benign 0.04
R6957:Dnah14 UTSW 1 181785175 missense possibly damaging 0.92
R6980:Dnah14 UTSW 1 181648230 missense probably benign 0.00
R7018:Dnah14 UTSW 1 181626944 missense possibly damaging 0.55
R7046:Dnah14 UTSW 1 181623003 missense probably benign 0.01
R7058:Dnah14 UTSW 1 181698049 missense probably benign 0.00
R7068:Dnah14 UTSW 1 181769790 missense probably benign 0.35
R7115:Dnah14 UTSW 1 181720145 missense probably damaging 1.00
R7130:Dnah14 UTSW 1 181745958 nonsense probably null
R7165:Dnah14 UTSW 1 181704535 missense probably benign 0.00
R7169:Dnah14 UTSW 1 181702365 missense probably benign 0.00
R7184:Dnah14 UTSW 1 181704529 nonsense probably null
R7232:Dnah14 UTSW 1 181757363 missense probably damaging 1.00
R7260:Dnah14 UTSW 1 181706744 missense probably damaging 0.99
R7276:Dnah14 UTSW 1 181685807 missense probably benign 0.41
R7290:Dnah14 UTSW 1 181628174 missense probably benign 0.20
R7314:Dnah14 UTSW 1 181785254 splice site probably null
R7326:Dnah14 UTSW 1 181598403 missense probably benign 0.02
R7363:Dnah14 UTSW 1 181690524 intron probably null
R7371:Dnah14 UTSW 1 181626885 missense probably benign 0.05
R7376:Dnah14 UTSW 1 181763402 missense probably benign 0.03
R7418:Dnah14 UTSW 1 181616742 missense possibly damaging 0.92
R7473:Dnah14 UTSW 1 181752139 missense probably damaging 0.99
R7514:Dnah14 UTSW 1 181628067 missense probably damaging 0.96
R7555:Dnah14 UTSW 1 181770054 missense probably benign 0.26
R7641:Dnah14 UTSW 1 181707533 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TAGTGTAGTCCCAAGTGCCG -3'
(R):5'- CAGATTGTACTTGGTAGTTCCCAC -3'

Sequencing Primer
(F):5'- GAGTGTCTGTCCCCTAGAGAACTAAG -3'
(R):5'- TTGGTAGTTCCCACCCAATAATACG -3'
Posted On2019-09-13