Mutagenetix > Incidental Mutation

Incidental Mutation 'R7336:Agrn'

569480

Institutional Source

Beutler Lab

Gene Symbol

Agrn

Ensembl Gene

ENSMUSG00000041936

Gene Name

agrin

Synonyms

NMF380, Agrin, nmf380

MMRRC Submission

Accession Numbers

Genbank: NM_021604; MGI: 87961

Essential gene?

Possibly non essential (E-score: 0.385) question?

Stock #

R7336 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

156165290-156197488 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 156174914 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Stop codon at position 828 (C828*)

Ref Sequence

ENSEMBL: ENSMUSP00000137931 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000071248] [ENSMUST00000105574] [ENSMUST00000105575] [ENSMUST00000180572]

AlphaFold

A2ASQ1

Predicted Effect

probably null
Transcript: ENSMUST00000071248
AA Change: C721*

SMART Domains

Protein: ENSMUSP00000071229
Gene: ENSMUSG00000041936
AA Change: C721*

Domain	Start	End	E-Value	Type
transmembrane domain	25	47	N/A	INTRINSIC
FOLN	66	91	8.25e-6	SMART
KAZAL	91	137	1.22e-17	SMART
FOLN	142	166	7.58e-5	SMART
EGF_like	142	181	7.38e1	SMART
KAZAL	166	212	1.51e-13	SMART
KAZAL	241	284	1.8e-6	SMART
KAZAL	310	356	1.55e-10	SMART
FOLN	362	384	8.25e-6	SMART
KAZAL	384	429	1.14e-17	SMART
KAZAL	449	494	6.43e-17	SMART
FOLN	496	519	2.94e-2	SMART
KAZAL	507	559	8.96e-16	SMART
low complexity region	565	572	N/A	INTRINSIC
KAZAL	599	645	1.12e-16	SMART
EGF_Lam	688	739	3.29e-15	SMART
EGF_Lam	742	786	6.7e-7	SMART
FOLN	795	817	1.94e-2	SMART
KAZAL	817	864	3.9e-16	SMART
low complexity region	889	906	N/A	INTRINSIC
low complexity region	949	978	N/A	INTRINSIC
SEA	1014	1139	5.57e-35	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000105574
AA Change: C721*

SMART Domains

Protein: ENSMUSP00000101199
Gene: ENSMUSG00000041936
AA Change: C721*

Domain	Start	End	E-Value	Type
transmembrane domain	25	47	N/A	INTRINSIC
FOLN	66	91	8.25e-6	SMART
KAZAL	91	137	1.22e-17	SMART
FOLN	142	166	7.58e-5	SMART
EGF_like	142	181	7.38e1	SMART
KAZAL	166	212	1.51e-13	SMART
KAZAL	241	284	1.8e-6	SMART
KAZAL	310	356	1.55e-10	SMART
FOLN	362	384	8.25e-6	SMART
KAZAL	384	429	1.14e-17	SMART
KAZAL	449	494	6.43e-17	SMART
FOLN	496	519	2.94e-2	SMART
KAZAL	507	559	8.96e-16	SMART
low complexity region	565	572	N/A	INTRINSIC
KAZAL	599	645	1.12e-16	SMART
EGF_Lam	688	739	3.29e-15	SMART
EGF_Lam	742	786	6.7e-7	SMART
FOLN	795	817	1.94e-2	SMART
KAZAL	817	864	3.9e-16	SMART
low complexity region	889	906	N/A	INTRINSIC
low complexity region	949	978	N/A	INTRINSIC
SEA	1014	1136	2.26e-35	SMART
low complexity region	1142	1169	N/A	INTRINSIC
low complexity region	1183	1198	N/A	INTRINSIC
EGF	1214	1249	1.49e-4	SMART
LamG	1274	1410	4e-45	SMART
EGF	1434	1468	2.23e-3	SMART
EGF	1473	1507	7.13e-2	SMART
LamG	1542	1678	6.51e-36	SMART
EGF	1699	1735	4.35e-6	SMART
LamG	1771	1907	5.01e-37	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000105575
AA Change: C721*

SMART Domains

Protein: ENSMUSP00000101200
Gene: ENSMUSG00000041936
AA Change: C721*

Domain	Start	End	E-Value	Type
transmembrane domain	25	47	N/A	INTRINSIC
FOLN	66	91	8.25e-6	SMART
KAZAL	91	137	1.22e-17	SMART
FOLN	142	166	7.58e-5	SMART
EGF_like	142	181	7.38e1	SMART
KAZAL	166	212	1.51e-13	SMART
KAZAL	241	284	1.8e-6	SMART
KAZAL	310	356	1.55e-10	SMART
FOLN	362	384	8.25e-6	SMART
KAZAL	384	429	1.14e-17	SMART
KAZAL	449	494	6.43e-17	SMART
FOLN	496	519	2.94e-2	SMART
KAZAL	507	559	8.96e-16	SMART
low complexity region	565	572	N/A	INTRINSIC
KAZAL	599	645	1.12e-16	SMART
EGF_Lam	688	739	3.29e-15	SMART
EGF_Lam	742	786	6.7e-7	SMART
FOLN	795	817	1.94e-2	SMART
KAZAL	817	864	3.9e-16	SMART
low complexity region	889	906	N/A	INTRINSIC
low complexity region	949	978	N/A	INTRINSIC
SEA	1014	1136	2.26e-35	SMART
low complexity region	1142	1169	N/A	INTRINSIC
low complexity region	1183	1198	N/A	INTRINSIC
EGF	1214	1249	1.49e-4	SMART
LamG	1274	1410	4e-45	SMART
EGF	1434	1468	2.23e-3	SMART
EGF	1473	1507	7.13e-2	SMART
LamG	1542	1682	9.2e-36	SMART
EGF	1703	1739	4.35e-6	SMART
LamG	1794	1930	5.01e-37	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000180572
AA Change: C828*

SMART Domains

Protein: ENSMUSP00000137931
Gene: ENSMUSG00000041936
AA Change: C828*

Domain	Start	End	E-Value	Type
signal peptide	1	31	N/A	INTRINSIC
Pfam:NtA	32	159	5.1e-91	PFAM
FOLN	173	198	8.25e-6	SMART
KAZAL	198	244	1.22e-17	SMART
FOLN	249	273	7.58e-5	SMART
EGF_like	249	288	7.38e1	SMART
KAZAL	273	319	1.51e-13	SMART
KAZAL	348	391	1.8e-6	SMART
KAZAL	417	463	1.55e-10	SMART
FOLN	469	491	8.25e-6	SMART
KAZAL	491	536	1.14e-17	SMART
KAZAL	556	601	6.43e-17	SMART
FOLN	603	626	2.94e-2	SMART
KAZAL	614	666	8.96e-16	SMART
low complexity region	672	679	N/A	INTRINSIC
KAZAL	706	752	1.12e-16	SMART
EGF_Lam	795	846	3.29e-15	SMART
EGF_Lam	849	893	6.7e-7	SMART
FOLN	902	924	1.94e-2	SMART
KAZAL	924	971	3.9e-16	SMART
low complexity region	996	1013	N/A	INTRINSIC
low complexity region	1056	1085	N/A	INTRINSIC
SEA	1121	1243	2.26e-35	SMART
low complexity region	1249	1276	N/A	INTRINSIC
low complexity region	1290	1305	N/A	INTRINSIC
EGF	1321	1356	1.49e-4	SMART
LamG	1381	1517	4e-45	SMART
EGF	1541	1575	2.23e-3	SMART
EGF	1580	1614	7.13e-2	SMART
LamG	1649	1785	6.51e-36	SMART
EGF	1806	1842	4.35e-6	SMART
LamG	1878	2014	5.01e-37	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 98.9%

Validation Efficiency

99% (80/81)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of several proteins that are critical in the development of the neuromuscular junction (NMJ), as identified in mouse knock-out studies. The encoded protein contains several laminin G, Kazal type serine protease inhibitor, and epidermal growth factor domains. Additional post-translational modifications occur to add glycosaminoglycans and disulfide bonds. In one family with congenital myasthenic syndrome affecting limb-girdle muscles, a mutation in this gene was found. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2015]
PHENOTYPE: Nullizygous mice display embryonic failure of NMJ formation, inability to breathe or move and perinatal lethality. Homozygotes for an ENU-induced allele show poor hindlimb motor control, myopathy, muscle atrophy, spasms and fiber-type switching, NMJ disaggregation, camptodactyly and premature death. [provided by MGI curators]

Allele List at MGI

All alleles(12) : Targeted, knock-out(4) Targeted, other(1) Gene trapped(7)

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca15	A	T	7: 120,388,233	Q1247H	possibly damaging	Het
Acsf2	G	C	11: 94,571,650	Q180E	probably benign	Het
Adamts8	A	G	9: 30,962,067	D856G	probably benign	Het
Ankub1	T	C	3: 57,665,687	T205A	probably benign	Het
Atm	A	T	9: 53,462,503	Y2150N	possibly damaging	Het
Barhl1	A	G	2: 28,909,843	F257L	probably benign	Het
Bcat2	T	A	7: 45,575,485	C27S	probably benign	Het
Bod1l	G	A	5: 41,821,524	R816C	probably damaging	Het
Btg3	A	G	16: 78,364,807	Y172H	probably benign	Het
C130079G13Rik	G	A	3: 59,932,753		probably null	Het
Cacna1d	T	C	14: 30,045,282	D1940G	probably benign	Het
Catsperg2	T	A	7: 29,706,601	N624I	possibly damaging	Het
Ccdc146	A	G	5: 21,303,112	V646A	probably benign	Het
Ccp110	C	T	7: 118,722,210	P363S	probably damaging	Het
Cct4	C	A	11: 23,001,564	T377K	possibly damaging	Het
Cep350	T	A	1: 155,862,276	H2607L	probably benign	Het
Cfap46	A	G	7: 139,620,104	F1954L	unknown	Het
Chat	C	T	14: 32,423,256		probably null	Het
Clasp2	A	G	9: 113,876,353		probably null	Het
Cldn9	T	C	17: 23,683,015	D212G	probably benign	Het
Cp	G	A	3: 19,964,532		probably null	Het
Cyfip1	T	A	7: 55,926,400	I1108N	possibly damaging	Het
Dnah14	A	G	1: 181,797,734	D4060G	probably damaging	Het
Dpyd	A	G	3: 119,064,921	T595A	probably damaging	Het
Eps8	G	A	6: 137,509,213	R434C	possibly damaging	Het
Fasl	A	G	1: 161,787,988	Y100H	probably damaging	Het
Fkbp9	A	T	6: 56,849,727	N104I	probably damaging	Het
Frmd4a	A	G	2: 4,473,214	T65A	possibly damaging	Het
Gm1110	T	C	9: 26,914,357	N102S	probably damaging	Het
Gm2381	T	C	7: 42,822,380	Q25R	possibly damaging	Het
Gtpbp2	A	G	17: 46,161,313	Y58C	probably damaging	Het
H2-T3	C	A	17: 36,187,345	K269N	probably damaging	Het
Icosl	C	A	10: 78,073,873	Y217*	probably null	Het
Il17rd	G	T	14: 27,087,546	R153L	probably benign	Het
Kif17	C	A	4: 138,298,306	T973K	possibly damaging	Het
Klk1b16	A	G	7: 44,141,483	I236M	probably benign	Het
Lgmn	G	A	12: 102,423,739		probably benign	Het
Lmbr1l	T	C	15: 98,913,587	D54G	possibly damaging	Het
Lrrc49	A	T	9: 60,677,191	I196N	possibly damaging	Het
Maml1	C	T	11: 50,266,449	A300T	possibly damaging	Het
Mapkap1	A	T	2: 34,533,817	Q293L	possibly damaging	Het
Mki67	T	C	7: 135,713,839	T69A	probably benign	Het
Mlph	G	A	1: 90,921,983		probably null	Het
Myh1	A	T	11: 67,220,609	M1625L	probably benign	Het
Myh3	G	T	11: 67,091,021	R781L	probably benign	Het
Nckap5	A	T	1: 126,026,049	I922K	probably benign	Het
Nlrp5	T	A	7: 23,417,634	M261K	probably damaging	Het
Olfr1317	A	T	2: 112,142,169	S75C	possibly damaging	Het
Olfr312	T	A	11: 58,831,924	Y257N	probably damaging	Het
Olfr396-ps1	G	A	11: 73,928,837	M204I	probably benign	Het
Olfr965	A	G	9: 39,719,610	N128D	probably benign	Het
Pak1	T	A	7: 97,888,972	V262E	probably benign	Het
Pigw	A	T	11: 84,877,104	D466E	probably damaging	Het
Pira2	A	T	7: 3,844,345	L115Q	probably damaging	Het
Rbm15	A	C	3: 107,333,116		probably benign	Het
Rfx1	A	G	8: 84,073,756		probably benign	Het
Rfx7	A	G	9: 72,593,357	Y133C	probably damaging	Het
Serpinb9d	T	A	13: 33,200,719	D226E	probably benign	Het
Sgk3	G	A	1: 9,884,476	A271T	possibly damaging	Het
Sh2d5	T	A	4: 138,256,839	C173S	probably benign	Het
Skint8	T	C	4: 111,939,572	V291A	probably benign	Het
Slc22a27	T	A	19: 7,926,689	N28Y	probably benign	Het
Slc25a54	G	A	3: 109,116,435	V449I	probably benign	Het
Slc39a9	T	C	12: 80,679,542	F255S	probably damaging	Het
Spata31d1c	C	T	13: 65,036,128	H495Y	probably damaging	Het
Stab2	G	A	10: 86,969,185	Q310*	probably null	Het
Supt16	C	A	14: 52,171,491	A809S	possibly damaging	Het
Tenm3	A	T	8: 48,236,177	M2125K	possibly damaging	Het
Tex2	G	A	11: 106,548,859	T565M	unknown	Het
Tll1	G	A	8: 64,025,142	A859V	probably damaging	Het
Tmem106c	C	T	15: 97,969,631	T232I	possibly damaging	Het
Tmem2	C	A	19: 21,826,145	Y847*	probably null	Het
Trim65	T	G	11: 116,128,290	D141A	probably benign	Het
Trim80	T	C	11: 115,441,216	F78S	probably damaging	Het
Txnrd1	T	A	10: 82,873,217	I83N	probably benign	Het
Vnn3	G	A	10: 23,851,908	G72D	probably benign	Het
Wasl	G	T	6: 24,619,687	P278Q	unknown	Het
Wdr62	A	T	7: 30,243,917	L951Q	probably damaging	Het
Zfp760	C	T	17: 21,723,833	T663I	unknown	Het

Other mutations in Agrn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00479:Agrn	APN	4	156170572	splice site	probably benign
IGL00811:Agrn	APN	4	156168774	missense	possibly damaging	0.70
IGL01066:Agrn	APN	4	156177343	missense	probably benign	0.00
IGL01412:Agrn	APN	4	156171034	splice site	probably benign
IGL01414:Agrn	APN	4	156195239	splice site	probably null
IGL02075:Agrn	APN	4	156170210	missense	probably benign	0.40
IGL02609:Agrn	APN	4	156175223	splice site	probably benign
IGL02669:Agrn	APN	4	156174561	splice site	probably benign
IGL02671:Agrn	APN	4	156174561	splice site	probably benign
IGL02672:Agrn	APN	4	156174561	splice site	probably benign
IGL02674:Agrn	APN	4	156174561	splice site	probably benign
IGL02724:Agrn	APN	4	156172807	nonsense	probably null
IGL02804:Agrn	APN	4	156174055	missense	probably benign	0.00
IGL02986:Agrn	APN	4	156178854	missense	possibly damaging	0.84
IGL03160:Agrn	APN	4	156170363	missense	probably damaging	0.98
BB004:Agrn	UTSW	4	156172809	missense	probably damaging	0.99
BB014:Agrn	UTSW	4	156172809	missense	probably damaging	0.99
F6893:Agrn	UTSW	4	156174179	missense	probably benign
R0092:Agrn	UTSW	4	156178953	missense	probably damaging	1.00
R0100:Agrn	UTSW	4	156174958	missense	probably damaging	1.00
R0100:Agrn	UTSW	4	156174958	missense	probably damaging	1.00
R0482:Agrn	UTSW	4	156173555	missense	probably damaging	0.98
R0531:Agrn	UTSW	4	156179434	missense	probably benign	0.38
R0536:Agrn	UTSW	4	156179553	missense	probably benign	0.01
R0690:Agrn	UTSW	4	156174453	missense	probably damaging	1.00
R0750:Agrn	UTSW	4	156166937	nonsense	probably null
R1079:Agrn	UTSW	4	156177225	missense	probably damaging	1.00
R1199:Agrn	UTSW	4	156172299	missense	probably benign	0.00
R1222:Agrn	UTSW	4	156177385	missense	probably damaging	0.99
R1534:Agrn	UTSW	4	156176684	missense	probably damaging	1.00
R1587:Agrn	UTSW	4	156179440	missense	probably damaging	0.99
R1625:Agrn	UTSW	4	156172860	missense	probably damaging	1.00
R1698:Agrn	UTSW	4	156166558	missense	probably benign	0.03
R1717:Agrn	UTSW	4	156166519	frame shift	probably null
R1718:Agrn	UTSW	4	156166519	frame shift	probably null
R1721:Agrn	UTSW	4	156175173	nonsense	probably null
R1765:Agrn	UTSW	4	156176827	nonsense	probably null
R1840:Agrn	UTSW	4	156167415	missense	probably damaging	1.00
R1865:Agrn	UTSW	4	156166519	frame shift	probably null
R2105:Agrn	UTSW	4	156177299	nonsense	probably null
R2265:Agrn	UTSW	4	156179218	missense	probably damaging	0.99
R2266:Agrn	UTSW	4	156179218	missense	probably damaging	0.99
R2269:Agrn	UTSW	4	156179218	missense	probably damaging	0.99
R2382:Agrn	UTSW	4	156176516	missense	probably damaging	0.97
R2497:Agrn	UTSW	4	156173811	missense	probably benign	0.28
R2509:Agrn	UTSW	4	156166424	splice site	probably null
R2510:Agrn	UTSW	4	156166424	splice site	probably null
R2511:Agrn	UTSW	4	156166424	splice site	probably null
R2994:Agrn	UTSW	4	156167328	missense	possibly damaging	0.79
R3824:Agrn	UTSW	4	156169302	missense	probably damaging	1.00
R4736:Agrn	UTSW	4	156172401	missense	probably benign	0.38
R4755:Agrn	UTSW	4	156173522	intron	probably benign
R4853:Agrn	UTSW	4	156185550	critical splice donor site	probably null
R4878:Agrn	UTSW	4	156170845	missense	probably damaging	1.00
R5117:Agrn	UTSW	4	156185553	missense	probably benign	0.30
R5228:Agrn	UTSW	4	156166946	missense	probably damaging	1.00
R5236:Agrn	UTSW	4	156178858	missense	possibly damaging	0.93
R5269:Agrn	UTSW	4	156168990	missense	probably benign	0.10
R5282:Agrn	UTSW	4	156173035	missense	probably damaging	1.00
R5449:Agrn	UTSW	4	156167280	critical splice donor site	probably null
R5560:Agrn	UTSW	4	156178497	missense	probably damaging	0.99
R5668:Agrn	UTSW	4	156167313	missense	probably damaging	0.97
R5725:Agrn	UTSW	4	156173875	missense	probably benign	0.25
R5967:Agrn	UTSW	4	156175103	missense	probably damaging	1.00
R6226:Agrn	UTSW	4	156173609	missense	probably damaging	0.96
R6338:Agrn	UTSW	4	156170585	missense	probably benign	0.17
R6351:Agrn	UTSW	4	156179434	missense	probably benign	0.00
R6437:Agrn	UTSW	4	156176778	missense	probably damaging	0.96
R6490:Agrn	UTSW	4	156167362	nonsense	probably null
R6909:Agrn	UTSW	4	156177007	missense	possibly damaging	0.90
R7110:Agrn	UTSW	4	156178875	missense	possibly damaging	0.88
R7123:Agrn	UTSW	4	156172840	missense	probably benign
R7163:Agrn	UTSW	4	156178509	missense	probably damaging	1.00
R7180:Agrn	UTSW	4	156171839	missense	probably benign	0.00
R7251:Agrn	UTSW	4	156174606	missense	probably damaging	1.00
R7289:Agrn	UTSW	4	156178932	missense	probably damaging	1.00
R7335:Agrn	UTSW	4	156176532	missense	probably damaging	1.00
R7406:Agrn	UTSW	4	156172301	missense	possibly damaging	0.93
R7460:Agrn	UTSW	4	156174424	missense	probably damaging	0.98
R7531:Agrn	UTSW	4	156169804	missense	probably damaging	1.00
R7585:Agrn	UTSW	4	156170674	missense	probably benign	0.08
R7646:Agrn	UTSW	4	156195354	missense	probably damaging	0.99
R7652:Agrn	UTSW	4	156169218	critical splice donor site	probably null
R7714:Agrn	UTSW	4	156195397	missense	probably damaging	1.00
R7751:Agrn	UTSW	4	156176429	missense	probably damaging	1.00
R7852:Agrn	UTSW	4	156169057	missense	probably benign	0.01
R7927:Agrn	UTSW	4	156172809	missense	probably damaging	0.99
R8039:Agrn	UTSW	4	156169011	missense	probably benign	0.12
R8056:Agrn	UTSW	4	156170411	missense	probably benign
R8061:Agrn	UTSW	4	156178954	missense	probably damaging	1.00
R8158:Agrn	UTSW	4	156173889	missense	probably benign
R8159:Agrn	UTSW	4	156172368	missense	probably benign	0.27
R8325:Agrn	UTSW	4	156173662	missense	probably benign	0.01
R8338:Agrn	UTSW	4	156168561	missense	probably benign	0.01
R8739:Agrn	UTSW	4	156172588	missense	probably benign
R8956:Agrn	UTSW	4	156166538	missense	probably damaging	0.99
R9094:Agrn	UTSW	4	156168807	missense	probably benign	0.01
R9112:Agrn	UTSW	4	156177057	missense	probably damaging	1.00
R9384:Agrn	UTSW	4	156172649	missense	probably damaging	1.00
R9472:Agrn	UTSW	4	156170384	missense
R9619:Agrn	UTSW	4	156174033	missense	probably benign	0.00
R9629:Agrn	UTSW	4	156172637	nonsense	probably null
R9732:Agrn	UTSW	4	156173989	missense	probably benign	0.13
R9749:Agrn	UTSW	4	156173657	missense	probably benign	0.02
R9757:Agrn	UTSW	4	156176778	missense	probably benign	0.03
R9792:Agrn	UTSW	4	156176672	missense	probably benign	0.09
R9793:Agrn	UTSW	4	156176672	missense	probably benign	0.09
Z1177:Agrn	UTSW	4	156171544	nonsense	probably null
Z1177:Agrn	UTSW	4	156179576	missense	possibly damaging	0.95

Predicted Primers

PCR Primer
(F):5'- ACCTGGATACGTTTCCCAAC -3'
(R):5'- AGGACAATGTCACTGCTGC -3'

Sequencing Primer
(F):5'- GGATACGTTTCCCAACCTGCC -3'
(R):5'- TCCCAGTGAGTATTTGAGCCCAG -3'

Posted On

2019-09-13