Incidental Mutation 'R7336:Bod1l'
ID569482
Institutional Source Beutler Lab
Gene Symbol Bod1l
Ensembl Gene ENSMUSG00000061755
Gene Namebiorientation of chromosomes in cell division 1-like
SynonymsA230054D04Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.947) question?
Stock #R7336 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location41787538-41844315 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 41821524 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 816 (R816C)
Ref Sequence ENSEMBL: ENSMUSP00000058618 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050556] [ENSMUST00000202908]
Predicted Effect probably damaging
Transcript: ENSMUST00000050556
AA Change: R816C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000058618
Gene: ENSMUSG00000061755
AA Change: R816C

DomainStartEndE-ValueType
low complexity region 5 47 N/A INTRINSIC
Pfam:COMPASS-Shg1 54 150 1.8e-28 PFAM
low complexity region 328 343 N/A INTRINSIC
low complexity region 415 435 N/A INTRINSIC
low complexity region 475 484 N/A INTRINSIC
coiled coil region 495 520 N/A INTRINSIC
coiled coil region 553 580 N/A INTRINSIC
low complexity region 820 840 N/A INTRINSIC
low complexity region 895 916 N/A INTRINSIC
low complexity region 996 1005 N/A INTRINSIC
low complexity region 1023 1041 N/A INTRINSIC
low complexity region 1272 1286 N/A INTRINSIC
low complexity region 1791 1809 N/A INTRINSIC
low complexity region 2695 2701 N/A INTRINSIC
low complexity region 2711 2729 N/A INTRINSIC
AT_hook 2807 2819 3.21e-1 SMART
coiled coil region 2908 2929 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000202908
AA Change: R816C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144359
Gene: ENSMUSG00000061755
AA Change: R816C

DomainStartEndE-ValueType
low complexity region 5 47 N/A INTRINSIC
Pfam:COMPASS-Shg1 54 150 2.9e-24 PFAM
low complexity region 328 343 N/A INTRINSIC
low complexity region 415 435 N/A INTRINSIC
low complexity region 475 484 N/A INTRINSIC
coiled coil region 495 520 N/A INTRINSIC
coiled coil region 553 580 N/A INTRINSIC
low complexity region 820 840 N/A INTRINSIC
low complexity region 895 916 N/A INTRINSIC
low complexity region 996 1005 N/A INTRINSIC
low complexity region 1023 1041 N/A INTRINSIC
low complexity region 1272 1286 N/A INTRINSIC
low complexity region 1791 1809 N/A INTRINSIC
low complexity region 2695 2701 N/A INTRINSIC
low complexity region 2711 2729 N/A INTRINSIC
AT_hook 2807 2819 1.9e-3 SMART
coiled coil region 2908 2929 N/A INTRINSIC
Meta Mutation Damage Score 0.4018 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 99% (80/81)
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 A T 7: 120,388,233 Q1247H possibly damaging Het
Acsf2 G C 11: 94,571,650 Q180E probably benign Het
Adamts8 A G 9: 30,962,067 D856G probably benign Het
Agrn A T 4: 156,174,914 C828* probably null Het
Ankub1 T C 3: 57,665,687 T205A probably benign Het
Atm A T 9: 53,462,503 Y2150N possibly damaging Het
Barhl1 A G 2: 28,909,843 F257L probably benign Het
Bcat2 T A 7: 45,575,485 C27S probably benign Het
Btg3 A G 16: 78,364,807 Y172H probably benign Het
C130079G13Rik G A 3: 59,932,753 probably null Het
Cacna1d T C 14: 30,045,282 D1940G probably benign Het
Catsperg2 T A 7: 29,706,601 N624I possibly damaging Het
Ccdc146 A G 5: 21,303,112 V646A probably benign Het
Ccp110 C T 7: 118,722,210 P363S probably damaging Het
Cct4 C A 11: 23,001,564 T377K possibly damaging Het
Cep350 T A 1: 155,862,276 H2607L probably benign Het
Cfap46 A G 7: 139,620,104 F1954L unknown Het
Chat C T 14: 32,423,256 probably null Het
Clasp2 A G 9: 113,876,353 probably null Het
Cldn9 T C 17: 23,683,015 D212G probably benign Het
Cp G A 3: 19,964,532 probably null Het
Cyfip1 T A 7: 55,926,400 I1108N possibly damaging Het
Dnah14 A G 1: 181,797,734 D4060G probably damaging Het
Dpyd A G 3: 119,064,921 T595A probably damaging Het
Eps8 G A 6: 137,509,213 R434C possibly damaging Het
Fasl A G 1: 161,787,988 Y100H probably damaging Het
Fkbp9 A T 6: 56,849,727 N104I probably damaging Het
Frmd4a A G 2: 4,473,214 T65A possibly damaging Het
Gm1110 T C 9: 26,914,357 N102S probably damaging Het
Gm2381 T C 7: 42,822,380 Q25R possibly damaging Het
Gtpbp2 A G 17: 46,161,313 Y58C probably damaging Het
H2-T3 C A 17: 36,187,345 K269N probably damaging Het
Icosl C A 10: 78,073,873 Y217* probably null Het
Il17rd G T 14: 27,087,546 R153L probably benign Het
Kif17 C A 4: 138,298,306 T973K possibly damaging Het
Klk1b16 A G 7: 44,141,483 I236M probably benign Het
Lgmn G A 12: 102,423,739 probably benign Het
Lmbr1l T C 15: 98,913,587 D54G possibly damaging Het
Lrrc49 A T 9: 60,677,191 I196N possibly damaging Het
Maml1 C T 11: 50,266,449 A300T possibly damaging Het
Mapkap1 A T 2: 34,533,817 Q293L possibly damaging Het
Mki67 T C 7: 135,713,839 T69A probably benign Het
Mlph G A 1: 90,921,983 probably null Het
Myh1 A T 11: 67,220,609 M1625L probably benign Het
Myh3 G T 11: 67,091,021 R781L probably benign Het
Nckap5 A T 1: 126,026,049 I922K probably benign Het
Nlrp5 T A 7: 23,417,634 M261K probably damaging Het
Olfr1317 A T 2: 112,142,169 S75C possibly damaging Het
Olfr312 T A 11: 58,831,924 Y257N probably damaging Het
Olfr396-ps1 G A 11: 73,928,837 M204I probably benign Het
Olfr965 A G 9: 39,719,610 N128D probably benign Het
Pak1 T A 7: 97,888,972 V262E probably benign Het
Pigw A T 11: 84,877,104 D466E probably damaging Het
Pira2 A T 7: 3,844,345 L115Q probably damaging Het
Rbm15 A C 3: 107,333,116 probably benign Het
Rfx1 A G 8: 84,073,756 probably benign Het
Rfx7 A G 9: 72,593,357 Y133C probably damaging Het
Serpinb9d T A 13: 33,200,719 D226E probably benign Het
Sgk3 G A 1: 9,884,476 A271T possibly damaging Het
Sh2d5 T A 4: 138,256,839 C173S probably benign Het
Skint8 T C 4: 111,939,572 V291A probably benign Het
Slc22a27 T A 19: 7,926,689 N28Y probably benign Het
Slc25a54 G A 3: 109,116,435 V449I probably benign Het
Slc39a9 T C 12: 80,679,542 F255S probably damaging Het
Spata31d1c C T 13: 65,036,128 H495Y probably damaging Het
Stab2 G A 10: 86,969,185 Q310* probably null Het
Supt16 C A 14: 52,171,491 A809S possibly damaging Het
Tenm3 A T 8: 48,236,177 M2125K possibly damaging Het
Tex2 G A 11: 106,548,859 T565M unknown Het
Tll1 G A 8: 64,025,142 A859V probably damaging Het
Tmem106c C T 15: 97,969,631 T232I possibly damaging Het
Tmem2 C A 19: 21,826,145 Y847* probably null Het
Trim65 T G 11: 116,128,290 D141A probably benign Het
Trim80 T C 11: 115,441,216 F78S probably damaging Het
Txnrd1 T A 10: 82,873,217 I83N probably benign Het
Vnn3 G A 10: 23,851,908 G72D probably benign Het
Wasl G T 6: 24,619,687 P278Q unknown Het
Wdr62 A T 7: 30,243,917 L951Q probably damaging Het
Zfp760 C T 17: 21,723,833 T663I unknown Het
Other mutations in Bod1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Bod1l APN 5 41816823 missense probably benign 0.00
IGL00990:Bod1l APN 5 41828865 missense probably benign 0.00
IGL01021:Bod1l APN 5 41838173 splice site probably benign
IGL01022:Bod1l APN 5 41794309 missense probably damaging 1.00
IGL01303:Bod1l APN 5 41817599 missense probably benign 0.00
IGL01654:Bod1l APN 5 41818176 missense probably damaging 0.99
IGL01748:Bod1l APN 5 41816961 missense probably benign 0.23
IGL01758:Bod1l APN 5 41826610 splice site probably benign
IGL01783:Bod1l APN 5 41808712 missense probably benign 0.02
IGL01790:Bod1l APN 5 41832250 missense probably benign 0.14
IGL01803:Bod1l APN 5 41817389 missense probably damaging 0.97
IGL01829:Bod1l APN 5 41820468 missense probably benign 0.25
IGL01952:Bod1l APN 5 41816954 missense possibly damaging 0.70
IGL02005:Bod1l APN 5 41816339 missense probably benign 0.01
IGL02110:Bod1l APN 5 41816453 missense probably damaging 0.97
IGL02129:Bod1l APN 5 41821850 missense probably benign 0.36
IGL02572:Bod1l APN 5 41821230 nonsense probably null
IGL02583:Bod1l APN 5 41816207 critical splice donor site probably null
IGL02643:Bod1l APN 5 41818805 missense possibly damaging 0.65
IGL02714:Bod1l APN 5 41816339 missense probably benign 0.01
IGL02728:Bod1l APN 5 41826503 missense probably damaging 1.00
IGL02752:Bod1l APN 5 41816463 missense possibly damaging 0.58
IGL02822:Bod1l APN 5 41794345 missense possibly damaging 0.94
IGL03032:Bod1l APN 5 41831584 missense probably benign 0.16
IGL03372:Bod1l APN 5 41805235 splice site probably benign
R0102:Bod1l UTSW 5 41817269 missense probably benign 0.36
R0147:Bod1l UTSW 5 41818697 missense possibly damaging 0.48
R0148:Bod1l UTSW 5 41818697 missense possibly damaging 0.48
R0490:Bod1l UTSW 5 41821892 missense probably damaging 0.96
R0577:Bod1l UTSW 5 41794887 missense probably damaging 1.00
R0587:Bod1l UTSW 5 41821637 missense probably benign 0.16
R0620:Bod1l UTSW 5 41801233 missense probably benign 0.16
R0626:Bod1l UTSW 5 41831537 missense probably damaging 1.00
R0785:Bod1l UTSW 5 41820016 missense probably benign 0.00
R1139:Bod1l UTSW 5 41831471 missense possibly damaging 0.64
R1165:Bod1l UTSW 5 41821053 missense probably benign 0.02
R1418:Bod1l UTSW 5 41819471 missense probably damaging 1.00
R1509:Bod1l UTSW 5 41819540 missense probably damaging 0.99
R1533:Bod1l UTSW 5 41822155 nonsense probably null
R1538:Bod1l UTSW 5 41816429 missense probably benign 0.00
R1591:Bod1l UTSW 5 41819220 missense probably benign 0.06
R1616:Bod1l UTSW 5 41808715 missense probably benign
R1628:Bod1l UTSW 5 41816982 missense probably benign 0.01
R1667:Bod1l UTSW 5 41816775 missense probably benign 0.01
R1869:Bod1l UTSW 5 41833675 missense possibly damaging 0.93
R1870:Bod1l UTSW 5 41833675 missense possibly damaging 0.93
R1993:Bod1l UTSW 5 41817336 missense probably damaging 1.00
R2060:Bod1l UTSW 5 41808742 missense possibly damaging 0.58
R2066:Bod1l UTSW 5 41805156 missense probably damaging 0.99
R2067:Bod1l UTSW 5 41817086 missense probably benign 0.11
R2073:Bod1l UTSW 5 41819189 missense probably benign 0.19
R2092:Bod1l UTSW 5 41831517 missense probably damaging 1.00
R2105:Bod1l UTSW 5 41832279 missense probably benign 0.00
R2243:Bod1l UTSW 5 41821545 missense possibly damaging 0.58
R2322:Bod1l UTSW 5 41827120 missense probably benign 0.09
R2849:Bod1l UTSW 5 41838076 missense probably damaging 1.00
R2883:Bod1l UTSW 5 41832259 missense probably benign 0.03
R3037:Bod1l UTSW 5 41822037 missense probably damaging 0.99
R3910:Bod1l UTSW 5 41817098 missense probably damaging 0.99
R3911:Bod1l UTSW 5 41817098 missense probably damaging 0.99
R3962:Bod1l UTSW 5 41808721 missense probably benign 0.07
R4235:Bod1l UTSW 5 41821455 missense probably damaging 1.00
R4308:Bod1l UTSW 5 41791813 missense possibly damaging 0.91
R4414:Bod1l UTSW 5 41820527 missense probably benign 0.04
R4535:Bod1l UTSW 5 41832231 missense probably benign 0.06
R4631:Bod1l UTSW 5 41817735 missense probably damaging 1.00
R4657:Bod1l UTSW 5 41818612 missense probably benign 0.00
R4782:Bod1l UTSW 5 41833663 missense probably benign 0.06
R4786:Bod1l UTSW 5 41819438 missense probably benign 0.43
R4840:Bod1l UTSW 5 41818472 missense probably damaging 1.00
R4877:Bod1l UTSW 5 41819994 missense probably benign 0.00
R4982:Bod1l UTSW 5 41820473 missense probably benign 0.00
R5152:Bod1l UTSW 5 41816543 missense probably benign 0.04
R5284:Bod1l UTSW 5 41820467 missense probably benign 0.05
R5354:Bod1l UTSW 5 41831537 missense probably damaging 1.00
R5369:Bod1l UTSW 5 41827183 missense probably damaging 1.00
R5486:Bod1l UTSW 5 41807181 missense possibly damaging 0.56
R5541:Bod1l UTSW 5 41791933 missense probably benign 0.06
R5610:Bod1l UTSW 5 41821874 missense probably damaging 1.00
R5655:Bod1l UTSW 5 41817044 missense probably benign 0.06
R5705:Bod1l UTSW 5 41817002 missense probably benign 0.01
R5819:Bod1l UTSW 5 41832605 missense probably benign 0.27
R5890:Bod1l UTSW 5 41820578 missense probably benign 0.43
R5923:Bod1l UTSW 5 41817419 missense probably damaging 1.00
R5991:Bod1l UTSW 5 41816863 nonsense probably null
R6017:Bod1l UTSW 5 41818760 missense probably benign 0.01
R6253:Bod1l UTSW 5 41826538 missense probably damaging 0.96
R6284:Bod1l UTSW 5 41818787 missense probably benign 0.35
R6483:Bod1l UTSW 5 41821082 missense probably benign 0.03
R6485:Bod1l UTSW 5 41817116 missense possibly damaging 0.93
R6575:Bod1l UTSW 5 41838068 missense probably damaging 1.00
R6679:Bod1l UTSW 5 41816666 missense probably damaging 0.97
R6788:Bod1l UTSW 5 41821873 nonsense probably null
R7006:Bod1l UTSW 5 41832552 missense probably damaging 1.00
R7095:Bod1l UTSW 5 41795068 critical splice donor site probably null
R7111:Bod1l UTSW 5 41813120 critical splice donor site probably null
R7190:Bod1l UTSW 5 41819938 missense probably benign 0.14
R7311:Bod1l UTSW 5 41794333 missense possibly damaging 0.57
R7341:Bod1l UTSW 5 41788857 missense probably benign 0.00
R7396:Bod1l UTSW 5 41831546 missense probably damaging 1.00
R7431:Bod1l UTSW 5 41813120 critical splice donor site probably null
R7442:Bod1l UTSW 5 41807179 missense probably damaging 0.96
R7539:Bod1l UTSW 5 41817860 missense possibly damaging 0.65
R7583:Bod1l UTSW 5 41833790 missense probably damaging 1.00
R7679:Bod1l UTSW 5 41820643 frame shift probably null
X0027:Bod1l UTSW 5 41832669 missense probably benign 0.20
X0058:Bod1l UTSW 5 41824018 missense probably damaging 1.00
Z1088:Bod1l UTSW 5 41808764 missense possibly damaging 0.95
Z1088:Bod1l UTSW 5 41821146 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTTTGAAGCTGCTATCGGC -3'
(R):5'- GAGCGACGAGACTGAACTTC -3'

Sequencing Primer
(F):5'- CGTTAGTGGAGTCTGTCTCACAC -3'
(R):5'- GACTGAACTTCACTCTTCTGAGAAGG -3'
Posted On2019-09-13