Incidental Mutation 'R7336:Tll1'
ID569500
Institutional Source Beutler Lab
Gene Symbol Tll1
Ensembl Gene ENSMUSG00000053626
Gene Nametolloid-like
SynonymsTll-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7336 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location64014931-64206271 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 64025142 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 859 (A859V)
Ref Sequence ENSEMBL: ENSMUSP00000070560 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066166]
Predicted Effect probably damaging
Transcript: ENSMUST00000066166
AA Change: A859V

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000070560
Gene: ENSMUSG00000053626
AA Change: A859V

DomainStartEndE-ValueType
ZnMc 153 295 4.12e-56 SMART
CUB 349 461 4.12e-44 SMART
CUB 462 574 3.81e-48 SMART
EGF_CA 574 615 2.28e-9 SMART
CUB 618 730 9.11e-46 SMART
EGF_CA 730 770 4.25e-9 SMART
CUB 774 886 2.01e-47 SMART
CUB 887 1003 7.19e-35 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an astacin-like, zinc-dependent, metalloprotease that belongs to the peptidase M12A family. This protease processes procollagen C-propeptides, such as chordin, pro-biglycan and pro-lysyl oxidase. Studies in mice suggest that this gene plays multiple roles in the development of mammalian heart, and is essential for the formation of the interventricular septum. Allelic variants of this gene are associated with atrial septal defect type 6. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2011]
PHENOTYPE: Homozygous null mice are embryonic lethal with death at midgestation from cardiac failure. Cardiac defects include incomplete formation of the ventricular septum and abnormal positioning of the heart and aorta. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 A T 7: 120,388,233 Q1247H possibly damaging Het
Acsf2 G C 11: 94,571,650 Q180E probably benign Het
Adamts8 A G 9: 30,962,067 D856G probably benign Het
Agrn A T 4: 156,174,914 C828* probably null Het
Ankub1 T C 3: 57,665,687 T205A probably benign Het
Atm A T 9: 53,462,503 Y2150N possibly damaging Het
Barhl1 A G 2: 28,909,843 F257L probably benign Het
Bcat2 T A 7: 45,575,485 C27S probably benign Het
Bod1l G A 5: 41,821,524 R816C probably damaging Het
Btg3 A G 16: 78,364,807 Y172H probably benign Het
C130079G13Rik G A 3: 59,932,753 probably null Het
Cacna1d T C 14: 30,045,282 D1940G probably benign Het
Catsperg2 T A 7: 29,706,601 N624I possibly damaging Het
Ccdc146 A G 5: 21,303,112 V646A probably benign Het
Ccp110 C T 7: 118,722,210 P363S probably damaging Het
Cct4 C A 11: 23,001,564 T377K possibly damaging Het
Cep350 T A 1: 155,862,276 H2607L probably benign Het
Cfap46 A G 7: 139,620,104 F1954L unknown Het
Chat C T 14: 32,423,256 probably null Het
Clasp2 A G 9: 113,876,353 probably null Het
Cldn9 T C 17: 23,683,015 D212G probably benign Het
Cp G A 3: 19,964,532 probably null Het
Cyfip1 T A 7: 55,926,400 I1108N possibly damaging Het
Dnah14 A G 1: 181,797,734 D4060G probably damaging Het
Dpyd A G 3: 119,064,921 T595A probably damaging Het
Eps8 G A 6: 137,509,213 R434C possibly damaging Het
Fasl A G 1: 161,787,988 Y100H probably damaging Het
Fkbp9 A T 6: 56,849,727 N104I probably damaging Het
Frmd4a A G 2: 4,473,214 T65A possibly damaging Het
Gm1110 T C 9: 26,914,357 N102S probably damaging Het
Gm2381 T C 7: 42,822,380 Q25R possibly damaging Het
Gtpbp2 A G 17: 46,161,313 Y58C probably damaging Het
H2-T3 C A 17: 36,187,345 K269N probably damaging Het
Icosl C A 10: 78,073,873 Y217* probably null Het
Il17rd G T 14: 27,087,546 R153L probably benign Het
Kif17 C A 4: 138,298,306 T973K possibly damaging Het
Klk1b16 A G 7: 44,141,483 I236M probably benign Het
Lgmn G A 12: 102,423,739 probably benign Het
Lmbr1l T C 15: 98,913,587 D54G possibly damaging Het
Lrrc49 A T 9: 60,677,191 I196N possibly damaging Het
Maml1 C T 11: 50,266,449 A300T possibly damaging Het
Mapkap1 A T 2: 34,533,817 Q293L possibly damaging Het
Mki67 T C 7: 135,713,839 T69A probably benign Het
Mlph G A 1: 90,921,983 probably null Het
Myh1 A T 11: 67,220,609 M1625L probably benign Het
Myh3 G T 11: 67,091,021 R781L probably benign Het
Nckap5 A T 1: 126,026,049 I922K probably benign Het
Nlrp5 T A 7: 23,417,634 M261K probably damaging Het
Olfr1317 A T 2: 112,142,169 S75C possibly damaging Het
Olfr312 T A 11: 58,831,924 Y257N probably damaging Het
Olfr396-ps1 G A 11: 73,928,837 M204I probably benign Het
Olfr965 A G 9: 39,719,610 N128D probably benign Het
Pak1 T A 7: 97,888,972 V262E probably benign Het
Pigw A T 11: 84,877,104 D466E probably damaging Het
Pira2 A T 7: 3,844,345 L115Q probably damaging Het
Rbm15 A C 3: 107,333,116 probably benign Het
Rfx1 A G 8: 84,073,756 probably benign Het
Rfx7 A G 9: 72,593,357 Y133C probably damaging Het
Serpinb9d T A 13: 33,200,719 D226E probably benign Het
Sgk3 G A 1: 9,884,476 A271T possibly damaging Het
Sh2d5 T A 4: 138,256,839 C173S probably benign Het
Skint8 T C 4: 111,939,572 V291A probably benign Het
Slc22a27 T A 19: 7,926,689 N28Y probably benign Het
Slc25a54 G A 3: 109,116,435 V449I probably benign Het
Slc39a9 T C 12: 80,679,542 F255S probably damaging Het
Spata31d1c C T 13: 65,036,128 H495Y probably damaging Het
Stab2 G A 10: 86,969,185 Q310* probably null Het
Supt16 C A 14: 52,171,491 A809S possibly damaging Het
Tenm3 A T 8: 48,236,177 M2125K possibly damaging Het
Tex2 G A 11: 106,548,859 T565M unknown Het
Tmem106c C T 15: 97,969,631 T232I possibly damaging Het
Tmem2 C A 19: 21,826,145 Y847* probably null Het
Trim65 T G 11: 116,128,290 D141A probably benign Het
Trim80 T C 11: 115,441,216 F78S probably damaging Het
Txnrd1 T A 10: 82,873,217 I83N probably benign Het
Vnn3 G A 10: 23,851,908 G72D probably benign Het
Wasl G T 6: 24,619,687 P278Q unknown Het
Wdr62 A T 7: 30,243,917 L951Q probably damaging Het
Zfp760 C T 17: 21,723,833 T663I unknown Het
Other mutations in Tll1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Tll1 APN 8 64016136 missense probably benign
IGL00583:Tll1 APN 8 64205292 missense probably benign
IGL00767:Tll1 APN 8 64071321 missense probably damaging 1.00
IGL01061:Tll1 APN 8 64038454 critical splice donor site probably null
IGL01077:Tll1 APN 8 64070232 missense probably benign 0.27
IGL01536:Tll1 APN 8 64074289 missense probably damaging 1.00
IGL02137:Tll1 APN 8 64016098 missense possibly damaging 0.73
IGL02168:Tll1 APN 8 64053967 missense possibly damaging 0.50
IGL02378:Tll1 APN 8 64017626 nonsense probably null
IGL02469:Tll1 APN 8 64070280 missense probably benign 0.41
IGL02504:Tll1 APN 8 64070237 missense possibly damaging 0.55
IGL02650:Tll1 APN 8 64046997 splice site probably benign
IGL02937:Tll1 APN 8 64205285 nonsense probably null
IGL03006:Tll1 APN 8 64074217 splice site probably benign
R0518:Tll1 UTSW 8 64098471 missense probably damaging 1.00
R0521:Tll1 UTSW 8 64098471 missense probably damaging 1.00
R0541:Tll1 UTSW 8 64038452 splice site probably null
R0612:Tll1 UTSW 8 64071310 missense possibly damaging 0.91
R0690:Tll1 UTSW 8 64074290 missense probably damaging 0.99
R0738:Tll1 UTSW 8 64101950 missense probably damaging 1.00
R1454:Tll1 UTSW 8 64038490 missense probably benign
R1619:Tll1 UTSW 8 64056273 missense probably benign 0.25
R1625:Tll1 UTSW 8 64041442 missense probably damaging 1.00
R1654:Tll1 UTSW 8 64117903 critical splice donor site probably null
R1663:Tll1 UTSW 8 64017686 missense probably benign 0.08
R1681:Tll1 UTSW 8 64085551 missense possibly damaging 0.93
R1713:Tll1 UTSW 8 64101873 missense probably damaging 0.99
R1908:Tll1 UTSW 8 64025107 missense probably damaging 0.98
R2118:Tll1 UTSW 8 64085557 missense probably benign 0.21
R2121:Tll1 UTSW 8 64085557 missense probably benign 0.21
R2124:Tll1 UTSW 8 64085557 missense probably benign 0.21
R2360:Tll1 UTSW 8 64051401 missense probably damaging 1.00
R2396:Tll1 UTSW 8 64070290 nonsense probably null
R3032:Tll1 UTSW 8 64098492 missense probably damaging 0.96
R3115:Tll1 UTSW 8 64053866 missense probably damaging 1.00
R3889:Tll1 UTSW 8 64205224 missense possibly damaging 0.77
R4126:Tll1 UTSW 8 64118014 missense possibly damaging 0.78
R4182:Tll1 UTSW 8 64041511 missense probably damaging 1.00
R4572:Tll1 UTSW 8 64056309 missense possibly damaging 0.81
R4677:Tll1 UTSW 8 64051377 missense probably benign 0.31
R4811:Tll1 UTSW 8 64085473 missense possibly damaging 0.72
R4904:Tll1 UTSW 8 64070199 missense probably benign 0.00
R4992:Tll1 UTSW 8 64093944 missense probably damaging 0.98
R5061:Tll1 UTSW 8 64053949 missense probably damaging 0.99
R5078:Tll1 UTSW 8 64093887 missense probably damaging 1.00
R5208:Tll1 UTSW 8 64051493 missense probably damaging 0.99
R5283:Tll1 UTSW 8 64101966 missense possibly damaging 0.68
R5399:Tll1 UTSW 8 64085488 missense probably damaging 1.00
R5699:Tll1 UTSW 8 64117940 missense probably damaging 0.98
R5986:Tll1 UTSW 8 64074263 missense probably damaging 0.99
R6019:Tll1 UTSW 8 64041491 missense possibly damaging 0.83
R6046:Tll1 UTSW 8 64053891 nonsense probably null
R6083:Tll1 UTSW 8 64038586 splice site probably null
R6125:Tll1 UTSW 8 64051487 missense probably damaging 1.00
R6222:Tll1 UTSW 8 64098534 missense probably benign 0.18
R6275:Tll1 UTSW 8 64051367 nonsense probably null
R6508:Tll1 UTSW 8 64098460 missense probably damaging 0.99
R6758:Tll1 UTSW 8 64041405 critical splice donor site probably null
R6782:Tll1 UTSW 8 64071281 missense probably benign 0.00
R6848:Tll1 UTSW 8 64098510 missense probably damaging 0.99
R7057:Tll1 UTSW 8 64101881 missense probably damaging 1.00
R7144:Tll1 UTSW 8 64124945 missense possibly damaging 0.90
R7244:Tll1 UTSW 8 64025188 missense probably benign 0.00
R7373:Tll1 UTSW 8 64051357 missense probably damaging 0.98
R7626:Tll1 UTSW 8 64098234 intron probably null
R7687:Tll1 UTSW 8 64121492 nonsense probably null
R7699:Tll1 UTSW 8 64093954 missense probably benign 0.00
R7700:Tll1 UTSW 8 64093954 missense probably benign 0.00
R7765:Tll1 UTSW 8 64051449 missense probably damaging 1.00
R7790:Tll1 UTSW 8 64025237 nonsense probably null
X0020:Tll1 UTSW 8 64017628 missense probably damaging 0.97
Z1176:Tll1 UTSW 8 64047163 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTACAAAGAGAGGAAAGTACAGTGCT -3'
(R):5'- ATGTGCTCCTTGGCTTAATTCCT -3'

Sequencing Primer
(F):5'- AGGAAAGTACAGTGCTAAGTGC -3'
(R):5'- ATTGATAGTTGATTTGTCCCCTAGAG -3'
Posted On2019-09-13