Mutagenetix > Incidental Mutation

Incidental Mutation 'R7336:Tll1'

569500

Institutional Source

Beutler Lab

Gene Symbol

Tll1

Ensembl Gene

ENSMUSG00000053626

Gene Name

tolloid-like

Synonyms

Tll-1

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7336 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

64014931-64206271 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 64025142 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Valine at position 859 (A859V)

Ref Sequence

ENSEMBL: ENSMUSP00000070560 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000066166]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000066166
AA Change: A859V

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000070560
Gene: ENSMUSG00000053626
AA Change: A859V

Domain	Start	End	E-Value	Type
ZnMc	153	295	4.12e-56	SMART
CUB	349	461	4.12e-44	SMART
CUB	462	574	3.81e-48	SMART
EGF_CA	574	615	2.28e-9	SMART
CUB	618	730	9.11e-46	SMART
EGF_CA	730	770	4.25e-9	SMART
CUB	774	886	2.01e-47	SMART
CUB	887	1003	7.19e-35	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 98.9%

Validation Efficiency

99% (80/81)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an astacin-like, zinc-dependent, metalloprotease that belongs to the peptidase M12A family. This protease processes procollagen C-propeptides, such as chordin, pro-biglycan and pro-lysyl oxidase. Studies in mice suggest that this gene plays multiple roles in the development of mammalian heart, and is essential for the formation of the interventricular septum. Allelic variants of this gene are associated with atrial septal defect type 6. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2011]
PHENOTYPE: Homozygous null mice are embryonic lethal with death at midgestation from cardiac failure. Cardiac defects include incomplete formation of the ventricular septum and abnormal positioning of the heart and aorta. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca15	A	T	7: 120,388,233	Q1247H	possibly damaging	Het
Acsf2	G	C	11: 94,571,650	Q180E	probably benign	Het
Adamts8	A	G	9: 30,962,067	D856G	probably benign	Het
Agrn	A	T	4: 156,174,914	C828*	probably null	Het
Ankub1	T	C	3: 57,665,687	T205A	probably benign	Het
Atm	A	T	9: 53,462,503	Y2150N	possibly damaging	Het
Barhl1	A	G	2: 28,909,843	F257L	probably benign	Het
Bcat2	T	A	7: 45,575,485	C27S	probably benign	Het
Bod1l	G	A	5: 41,821,524	R816C	probably damaging	Het
Btg3	A	G	16: 78,364,807	Y172H	probably benign	Het
C130079G13Rik	G	A	3: 59,932,753		probably null	Het
Cacna1d	T	C	14: 30,045,282	D1940G	probably benign	Het
Catsperg2	T	A	7: 29,706,601	N624I	possibly damaging	Het
Ccdc146	A	G	5: 21,303,112	V646A	probably benign	Het
Ccp110	C	T	7: 118,722,210	P363S	probably damaging	Het
Cct4	C	A	11: 23,001,564	T377K	possibly damaging	Het
Cep350	T	A	1: 155,862,276	H2607L	probably benign	Het
Cfap46	A	G	7: 139,620,104	F1954L	unknown	Het
Chat	C	T	14: 32,423,256		probably null	Het
Clasp2	A	G	9: 113,876,353		probably null	Het
Cldn9	T	C	17: 23,683,015	D212G	probably benign	Het
Cp	G	A	3: 19,964,532		probably null	Het
Cyfip1	T	A	7: 55,926,400	I1108N	possibly damaging	Het
Dnah14	A	G	1: 181,797,734	D4060G	probably damaging	Het
Dpyd	A	G	3: 119,064,921	T595A	probably damaging	Het
Eps8	G	A	6: 137,509,213	R434C	possibly damaging	Het
Fasl	A	G	1: 161,787,988	Y100H	probably damaging	Het
Fkbp9	A	T	6: 56,849,727	N104I	probably damaging	Het
Frmd4a	A	G	2: 4,473,214	T65A	possibly damaging	Het
Gm1110	T	C	9: 26,914,357	N102S	probably damaging	Het
Gm2381	T	C	7: 42,822,380	Q25R	possibly damaging	Het
Gtpbp2	A	G	17: 46,161,313	Y58C	probably damaging	Het
H2-T3	C	A	17: 36,187,345	K269N	probably damaging	Het
Icosl	C	A	10: 78,073,873	Y217*	probably null	Het
Il17rd	G	T	14: 27,087,546	R153L	probably benign	Het
Kif17	C	A	4: 138,298,306	T973K	possibly damaging	Het
Klk1b16	A	G	7: 44,141,483	I236M	probably benign	Het
Lgmn	G	A	12: 102,423,739		probably benign	Het
Lmbr1l	T	C	15: 98,913,587	D54G	possibly damaging	Het
Lrrc49	A	T	9: 60,677,191	I196N	possibly damaging	Het
Maml1	C	T	11: 50,266,449	A300T	possibly damaging	Het
Mapkap1	A	T	2: 34,533,817	Q293L	possibly damaging	Het
Mki67	T	C	7: 135,713,839	T69A	probably benign	Het
Mlph	G	A	1: 90,921,983		probably null	Het
Myh1	A	T	11: 67,220,609	M1625L	probably benign	Het
Myh3	G	T	11: 67,091,021	R781L	probably benign	Het
Nckap5	A	T	1: 126,026,049	I922K	probably benign	Het
Nlrp5	T	A	7: 23,417,634	M261K	probably damaging	Het
Olfr1317	A	T	2: 112,142,169	S75C	possibly damaging	Het
Olfr312	T	A	11: 58,831,924	Y257N	probably damaging	Het
Olfr396-ps1	G	A	11: 73,928,837	M204I	probably benign	Het
Olfr965	A	G	9: 39,719,610	N128D	probably benign	Het
Pak1	T	A	7: 97,888,972	V262E	probably benign	Het
Pigw	A	T	11: 84,877,104	D466E	probably damaging	Het
Pira2	A	T	7: 3,844,345	L115Q	probably damaging	Het
Rbm15	A	C	3: 107,333,116		probably benign	Het
Rfx1	A	G	8: 84,073,756		probably benign	Het
Rfx7	A	G	9: 72,593,357	Y133C	probably damaging	Het
Serpinb9d	T	A	13: 33,200,719	D226E	probably benign	Het
Sgk3	G	A	1: 9,884,476	A271T	possibly damaging	Het
Sh2d5	T	A	4: 138,256,839	C173S	probably benign	Het
Skint8	T	C	4: 111,939,572	V291A	probably benign	Het
Slc22a27	T	A	19: 7,926,689	N28Y	probably benign	Het
Slc25a54	G	A	3: 109,116,435	V449I	probably benign	Het
Slc39a9	T	C	12: 80,679,542	F255S	probably damaging	Het
Spata31d1c	C	T	13: 65,036,128	H495Y	probably damaging	Het
Stab2	G	A	10: 86,969,185	Q310*	probably null	Het
Supt16	C	A	14: 52,171,491	A809S	possibly damaging	Het
Tenm3	A	T	8: 48,236,177	M2125K	possibly damaging	Het
Tex2	G	A	11: 106,548,859	T565M	unknown	Het
Tmem106c	C	T	15: 97,969,631	T232I	possibly damaging	Het
Tmem2	C	A	19: 21,826,145	Y847*	probably null	Het
Trim65	T	G	11: 116,128,290	D141A	probably benign	Het
Trim80	T	C	11: 115,441,216	F78S	probably damaging	Het
Txnrd1	T	A	10: 82,873,217	I83N	probably benign	Het
Vnn3	G	A	10: 23,851,908	G72D	probably benign	Het
Wasl	G	T	6: 24,619,687	P278Q	unknown	Het
Wdr62	A	T	7: 30,243,917	L951Q	probably damaging	Het
Zfp760	C	T	17: 21,723,833	T663I	unknown	Het

Other mutations in Tll1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00163:Tll1	APN	8	64016136	missense	probably benign
IGL00583:Tll1	APN	8	64205292	missense	probably benign
IGL00767:Tll1	APN	8	64071321	missense	probably damaging	1.00
IGL01061:Tll1	APN	8	64038454	critical splice donor site	probably null
IGL01077:Tll1	APN	8	64070232	missense	probably benign	0.27
IGL01536:Tll1	APN	8	64074289	missense	probably damaging	1.00
IGL02137:Tll1	APN	8	64016098	missense	possibly damaging	0.73
IGL02168:Tll1	APN	8	64053967	missense	possibly damaging	0.50
IGL02378:Tll1	APN	8	64017626	nonsense	probably null
IGL02469:Tll1	APN	8	64070280	missense	probably benign	0.41
IGL02504:Tll1	APN	8	64070237	missense	possibly damaging	0.55
IGL02650:Tll1	APN	8	64046997	splice site	probably benign
IGL02937:Tll1	APN	8	64205285	nonsense	probably null
IGL03006:Tll1	APN	8	64074217	splice site	probably benign
R0518:Tll1	UTSW	8	64098471	missense	probably damaging	1.00
R0521:Tll1	UTSW	8	64098471	missense	probably damaging	1.00
R0541:Tll1	UTSW	8	64038452	splice site	probably null
R0612:Tll1	UTSW	8	64071310	missense	possibly damaging	0.91
R0690:Tll1	UTSW	8	64074290	missense	probably damaging	0.99
R0738:Tll1	UTSW	8	64101950	missense	probably damaging	1.00
R1454:Tll1	UTSW	8	64038490	missense	probably benign
R1619:Tll1	UTSW	8	64056273	missense	probably benign	0.25
R1625:Tll1	UTSW	8	64041442	missense	probably damaging	1.00
R1654:Tll1	UTSW	8	64117903	critical splice donor site	probably null
R1663:Tll1	UTSW	8	64017686	missense	probably benign	0.08
R1681:Tll1	UTSW	8	64085551	missense	possibly damaging	0.93
R1713:Tll1	UTSW	8	64101873	missense	probably damaging	0.99
R1908:Tll1	UTSW	8	64025107	missense	probably damaging	0.98
R2118:Tll1	UTSW	8	64085557	missense	probably benign	0.21
R2121:Tll1	UTSW	8	64085557	missense	probably benign	0.21
R2124:Tll1	UTSW	8	64085557	missense	probably benign	0.21
R2360:Tll1	UTSW	8	64051401	missense	probably damaging	1.00
R2396:Tll1	UTSW	8	64070290	nonsense	probably null
R3032:Tll1	UTSW	8	64098492	missense	probably damaging	0.96
R3115:Tll1	UTSW	8	64053866	missense	probably damaging	1.00
R3889:Tll1	UTSW	8	64205224	missense	possibly damaging	0.77
R4126:Tll1	UTSW	8	64118014	missense	possibly damaging	0.78
R4182:Tll1	UTSW	8	64041511	missense	probably damaging	1.00
R4572:Tll1	UTSW	8	64056309	missense	possibly damaging	0.81
R4677:Tll1	UTSW	8	64051377	missense	probably benign	0.31
R4811:Tll1	UTSW	8	64085473	missense	possibly damaging	0.72
R4904:Tll1	UTSW	8	64070199	missense	probably benign	0.00
R4992:Tll1	UTSW	8	64093944	missense	probably damaging	0.98
R5061:Tll1	UTSW	8	64053949	missense	probably damaging	0.99
R5078:Tll1	UTSW	8	64093887	missense	probably damaging	1.00
R5208:Tll1	UTSW	8	64051493	missense	probably damaging	0.99
R5283:Tll1	UTSW	8	64101966	missense	possibly damaging	0.68
R5399:Tll1	UTSW	8	64085488	missense	probably damaging	1.00
R5699:Tll1	UTSW	8	64117940	missense	probably damaging	0.98
R5986:Tll1	UTSW	8	64074263	missense	probably damaging	0.99
R6019:Tll1	UTSW	8	64041491	missense	possibly damaging	0.83
R6046:Tll1	UTSW	8	64053891	nonsense	probably null
R6083:Tll1	UTSW	8	64038586	splice site	probably null
R6125:Tll1	UTSW	8	64051487	missense	probably damaging	1.00
R6222:Tll1	UTSW	8	64098534	missense	probably benign	0.18
R6275:Tll1	UTSW	8	64051367	nonsense	probably null
R6508:Tll1	UTSW	8	64098460	missense	probably damaging	0.99
R6758:Tll1	UTSW	8	64041405	critical splice donor site	probably null
R6782:Tll1	UTSW	8	64071281	missense	probably benign	0.00
R6848:Tll1	UTSW	8	64098510	missense	probably damaging	0.99
R7057:Tll1	UTSW	8	64101881	missense	probably damaging	1.00
R7144:Tll1	UTSW	8	64124945	missense	possibly damaging	0.90
R7244:Tll1	UTSW	8	64025188	missense	probably benign	0.00
R7373:Tll1	UTSW	8	64051357	missense	probably damaging	0.98
R7626:Tll1	UTSW	8	64098234	splice site	probably null
R7687:Tll1	UTSW	8	64121492	nonsense	probably null
R7699:Tll1	UTSW	8	64093954	missense	probably benign	0.00
R7700:Tll1	UTSW	8	64093954	missense	probably benign	0.00
R7765:Tll1	UTSW	8	64051449	missense	probably damaging	1.00
R7790:Tll1	UTSW	8	64025237	nonsense	probably null
R7954:Tll1	UTSW	8	64118534	missense	probably damaging	1.00
R8710:Tll1	UTSW	8	64124906	missense	possibly damaging	0.77
R8792:Tll1	UTSW	8	64085465	missense	probably damaging	1.00
R9134:Tll1	UTSW	8	64016167	missense	possibly damaging	0.91
R9444:Tll1	UTSW	8	64016089	missense	probably damaging	1.00
R9539:Tll1	UTSW	8	64041423	missense	probably damaging	1.00
X0020:Tll1	UTSW	8	64017628	missense	probably damaging	0.97
Z1176:Tll1	UTSW	8	64047163	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTACAAAGAGAGGAAAGTACAGTGCT -3'
(R):5'- ATGTGCTCCTTGGCTTAATTCCT -3'

Sequencing Primer
(F):5'- AGGAAAGTACAGTGCTAAGTGC -3'
(R):5'- ATTGATAGTTGATTTGTCCCCTAGAG -3'

Posted On

2019-09-13