Incidental Mutation 'R7336:Acsf2'
ID 569519
Institutional Source Beutler Lab
Gene Symbol Acsf2
Ensembl Gene ENSMUSG00000076435
Gene Name acyl-CoA synthetase family member 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7336 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 94557102-94601871 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to C at 94571650 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Glutamic Acid at position 180 (Q180E)
Ref Sequence ENSEMBL: ENSMUSP00000099453 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040418] [ENSMUST00000103164]
AlphaFold Q8VCW8
Predicted Effect probably benign
Transcript: ENSMUST00000040418
SMART Domains Protein: ENSMUSP00000047844
Gene: ENSMUSG00000039084

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
LRRNT 21 54 1.7e-7 SMART
LRR_TYP 73 96 9.58e-3 SMART
LRR_TYP 97 120 1.45e-2 SMART
LRR_TYP 121 144 1.69e-3 SMART
LRR_TYP 145 168 6.42e-4 SMART
LRR 170 192 2.2e1 SMART
LRR 193 216 2.14e1 SMART
LRR_TYP 217 240 4.17e-3 SMART
LRR 245 265 2.27e2 SMART
LRR 266 289 3.36e1 SMART
LRRCT 299 346 1.1e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000103164
AA Change: Q180E

PolyPhen 2 Score 0.106 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000099453
Gene: ENSMUSG00000076435
AA Change: Q180E

DomainStartEndE-ValueType
Pfam:AMP-binding 78 516 3.9e-100 PFAM
Pfam:AMP-binding_C 524 599 1.7e-20 PFAM
Meta Mutation Damage Score 0.0679 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 99% (80/81)
MGI Phenotype PHENOTYPE: Phenotypic analysis of mice homozygous for a gene trap allele indicates this mutation has no notable phenotype in any parameter tested. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 A T 7: 120,388,233 Q1247H possibly damaging Het
Adamts8 A G 9: 30,962,067 D856G probably benign Het
Agrn A T 4: 156,174,914 C828* probably null Het
Ankub1 T C 3: 57,665,687 T205A probably benign Het
Atm A T 9: 53,462,503 Y2150N possibly damaging Het
Barhl1 A G 2: 28,909,843 F257L probably benign Het
Bcat2 T A 7: 45,575,485 C27S probably benign Het
Bod1l G A 5: 41,821,524 R816C probably damaging Het
Btg3 A G 16: 78,364,807 Y172H probably benign Het
C130079G13Rik G A 3: 59,932,753 probably null Het
Cacna1d T C 14: 30,045,282 D1940G probably benign Het
Catsperg2 T A 7: 29,706,601 N624I possibly damaging Het
Ccdc146 A G 5: 21,303,112 V646A probably benign Het
Ccp110 C T 7: 118,722,210 P363S probably damaging Het
Cct4 C A 11: 23,001,564 T377K possibly damaging Het
Cep350 T A 1: 155,862,276 H2607L probably benign Het
Cfap46 A G 7: 139,620,104 F1954L unknown Het
Chat C T 14: 32,423,256 probably null Het
Clasp2 A G 9: 113,876,353 probably null Het
Cldn9 T C 17: 23,683,015 D212G probably benign Het
Cp G A 3: 19,964,532 probably null Het
Cyfip1 T A 7: 55,926,400 I1108N possibly damaging Het
Dnah14 A G 1: 181,797,734 D4060G probably damaging Het
Dpyd A G 3: 119,064,921 T595A probably damaging Het
Eps8 G A 6: 137,509,213 R434C possibly damaging Het
Fasl A G 1: 161,787,988 Y100H probably damaging Het
Fkbp9 A T 6: 56,849,727 N104I probably damaging Het
Frmd4a A G 2: 4,473,214 T65A possibly damaging Het
Gm1110 T C 9: 26,914,357 N102S probably damaging Het
Gm2381 T C 7: 42,822,380 Q25R possibly damaging Het
Gtpbp2 A G 17: 46,161,313 Y58C probably damaging Het
H2-T3 C A 17: 36,187,345 K269N probably damaging Het
Icosl C A 10: 78,073,873 Y217* probably null Het
Il17rd G T 14: 27,087,546 R153L probably benign Het
Kif17 C A 4: 138,298,306 T973K possibly damaging Het
Klk1b16 A G 7: 44,141,483 I236M probably benign Het
Lgmn G A 12: 102,423,739 probably benign Het
Lmbr1l T C 15: 98,913,587 D54G possibly damaging Het
Lrrc49 A T 9: 60,677,191 I196N possibly damaging Het
Maml1 C T 11: 50,266,449 A300T possibly damaging Het
Mapkap1 A T 2: 34,533,817 Q293L possibly damaging Het
Mki67 T C 7: 135,713,839 T69A probably benign Het
Mlph G A 1: 90,921,983 probably null Het
Myh1 A T 11: 67,220,609 M1625L probably benign Het
Myh3 G T 11: 67,091,021 R781L probably benign Het
Nckap5 A T 1: 126,026,049 I922K probably benign Het
Nlrp5 T A 7: 23,417,634 M261K probably damaging Het
Olfr1317 A T 2: 112,142,169 S75C possibly damaging Het
Olfr312 T A 11: 58,831,924 Y257N probably damaging Het
Olfr396-ps1 G A 11: 73,928,837 M204I probably benign Het
Olfr965 A G 9: 39,719,610 N128D probably benign Het
Pak1 T A 7: 97,888,972 V262E probably benign Het
Pigw A T 11: 84,877,104 D466E probably damaging Het
Pira2 A T 7: 3,844,345 L115Q probably damaging Het
Rbm15 A C 3: 107,333,116 probably benign Het
Rfx1 A G 8: 84,073,756 probably benign Het
Rfx7 A G 9: 72,593,357 Y133C probably damaging Het
Serpinb9d T A 13: 33,200,719 D226E probably benign Het
Sgk3 G A 1: 9,884,476 A271T possibly damaging Het
Sh2d5 T A 4: 138,256,839 C173S probably benign Het
Skint8 T C 4: 111,939,572 V291A probably benign Het
Slc22a27 T A 19: 7,926,689 N28Y probably benign Het
Slc25a54 G A 3: 109,116,435 V449I probably benign Het
Slc39a9 T C 12: 80,679,542 F255S probably damaging Het
Spata31d1c C T 13: 65,036,128 H495Y probably damaging Het
Stab2 G A 10: 86,969,185 Q310* probably null Het
Supt16 C A 14: 52,171,491 A809S possibly damaging Het
Tenm3 A T 8: 48,236,177 M2125K possibly damaging Het
Tex2 G A 11: 106,548,859 T565M unknown Het
Tll1 G A 8: 64,025,142 A859V probably damaging Het
Tmem106c C T 15: 97,969,631 T232I possibly damaging Het
Tmem2 C A 19: 21,826,145 Y847* probably null Het
Trim65 T G 11: 116,128,290 D141A probably benign Het
Trim80 T C 11: 115,441,216 F78S probably damaging Het
Txnrd1 T A 10: 82,873,217 I83N probably benign Het
Vnn3 G A 10: 23,851,908 G72D probably benign Het
Wasl G T 6: 24,619,687 P278Q unknown Het
Wdr62 A T 7: 30,243,917 L951Q probably damaging Het
Zfp760 C T 17: 21,723,833 T663I unknown Het
Other mutations in Acsf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01123:Acsf2 APN 11 94570450 missense probably benign 0.00
IGL02218:Acsf2 APN 11 94601763 missense probably benign 0.00
IGL02602:Acsf2 APN 11 94570465 splice site probably benign
Citrus UTSW 11 94571650 missense probably benign 0.11
Cocktail UTSW 11 94570385 missense probably benign 0.06
limonene UTSW 11 94562888 missense probably damaging 0.99
R0047:Acsf2 UTSW 11 94569342 missense probably benign 0.01
R0194:Acsf2 UTSW 11 94561370 missense probably benign 0.00
R1400:Acsf2 UTSW 11 94570316 missense probably benign 0.07
R1403:Acsf2 UTSW 11 94562874 missense probably benign 0.11
R1403:Acsf2 UTSW 11 94562874 missense probably benign 0.11
R1512:Acsf2 UTSW 11 94561398 splice site probably benign
R2007:Acsf2 UTSW 11 94571640 missense possibly damaging 0.88
R2271:Acsf2 UTSW 11 94558873 nonsense probably null
R3610:Acsf2 UTSW 11 94561346 missense probably benign 0.00
R4447:Acsf2 UTSW 11 94569359 missense possibly damaging 0.68
R4717:Acsf2 UTSW 11 94559546 missense probably benign 0.02
R4857:Acsf2 UTSW 11 94569338 missense probably benign 0.07
R4974:Acsf2 UTSW 11 94569329 missense possibly damaging 0.77
R5090:Acsf2 UTSW 11 94571269 critical splice donor site probably null
R5185:Acsf2 UTSW 11 94562911 missense probably damaging 1.00
R5732:Acsf2 UTSW 11 94569942 unclassified probably benign
R5797:Acsf2 UTSW 11 94571679 missense probably damaging 0.98
R5872:Acsf2 UTSW 11 94573149 missense probably benign 0.16
R6350:Acsf2 UTSW 11 94558330 missense probably benign 0.12
R6903:Acsf2 UTSW 11 94559591 missense probably benign 0.03
R6912:Acsf2 UTSW 11 94570380 missense probably benign
R7531:Acsf2 UTSW 11 94573231 splice site probably null
R8026:Acsf2 UTSW 11 94562888 missense probably damaging 0.99
R8231:Acsf2 UTSW 11 94561362 missense probably benign 0.01
R8355:Acsf2 UTSW 11 94570624 missense probably benign 0.00
R8486:Acsf2 UTSW 11 94569960 missense probably damaging 0.98
R8525:Acsf2 UTSW 11 94572620 missense probably benign 0.21
R8956:Acsf2 UTSW 11 94570385 missense probably benign 0.06
R9288:Acsf2 UTSW 11 94573218 missense probably benign 0.04
R9481:Acsf2 UTSW 11 94573218 missense probably benign 0.04
R9564:Acsf2 UTSW 11 94573065 missense possibly damaging 0.88
R9620:Acsf2 UTSW 11 94572586 nonsense probably null
R9671:Acsf2 UTSW 11 94569976 missense probably benign 0.27
R9742:Acsf2 UTSW 11 94573137 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- AGCCCAGGAAGATATCAGCTC -3'
(R):5'- GGGTATACATGACTGCATTAGAGG -3'

Sequencing Primer
(F):5'- GATATCAGCTCCACCTTTGTAGGAG -3'
(R):5'- GCTACATGGGTATGTCAGGATAG -3'
Posted On 2019-09-13