Incidental Mutation 'R7336:Supt16'
ID569529
Institutional Source Beutler Lab
Gene Symbol Supt16
Ensembl Gene ENSMUSG00000035726
Gene Namesuppressor of Ty 16
SynonymsSupt16h, Spt16, Fact140, Cdc68
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.963) question?
Stock #R7336 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location52160414-52197416 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 52171491 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 809 (A809S)
Ref Sequence ENSEMBL: ENSMUSP00000042283 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046709]
Predicted Effect possibly damaging
Transcript: ENSMUST00000046709
AA Change: A809S

PolyPhen 2 Score 0.929 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000042283
Gene: ENSMUSG00000035726
AA Change: A809S

DomainStartEndE-ValueType
FACT-Spt16_Nlob 5 168 2.95e-87 SMART
Pfam:Peptidase_M24 181 411 2.9e-35 PFAM
low complexity region 435 449 N/A INTRINSIC
coiled coil region 462 493 N/A INTRINSIC
SPT16 529 689 3.38e-96 SMART
Rtt106 806 896 1.61e-38 SMART
low complexity region 926 946 N/A INTRINSIC
low complexity region 951 988 N/A INTRINSIC
coiled coil region 994 1023 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Transcription of protein-coding genes can be reconstituted on naked DNA with only the general transcription factors and RNA polymerase II. However, this minimal system cannot transcribe DNA packaged into chromatin, indicating that accessory factors may facilitate access to DNA. One such factor, FACT (facilitates chromatin transcription), interacts specifically with histones H2A/H2B to effect nucleosome disassembly and transcription elongation. FACT is composed of an 80 kDa subunit and a 140 kDa subunit; this gene encodes the 140 kDa subunit. [provided by RefSeq, Feb 2009]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 A T 7: 120,388,233 Q1247H possibly damaging Het
Acsf2 G C 11: 94,571,650 Q180E probably benign Het
Adamts8 A G 9: 30,962,067 D856G probably benign Het
Agrn A T 4: 156,174,914 C828* probably null Het
Ankub1 T C 3: 57,665,687 T205A probably benign Het
Atm A T 9: 53,462,503 Y2150N possibly damaging Het
Barhl1 A G 2: 28,909,843 F257L probably benign Het
Bcat2 T A 7: 45,575,485 C27S probably benign Het
Bod1l G A 5: 41,821,524 R816C probably damaging Het
Btg3 A G 16: 78,364,807 Y172H probably benign Het
C130079G13Rik G A 3: 59,932,753 probably null Het
Cacna1d T C 14: 30,045,282 D1940G probably benign Het
Catsperg2 T A 7: 29,706,601 N624I possibly damaging Het
Ccdc146 A G 5: 21,303,112 V646A probably benign Het
Ccp110 C T 7: 118,722,210 P363S probably damaging Het
Cct4 C A 11: 23,001,564 T377K possibly damaging Het
Cep350 T A 1: 155,862,276 H2607L probably benign Het
Cfap46 A G 7: 139,620,104 F1954L unknown Het
Chat C T 14: 32,423,256 probably null Het
Clasp2 A G 9: 113,876,353 probably null Het
Cldn9 T C 17: 23,683,015 D212G probably benign Het
Cp G A 3: 19,964,532 probably null Het
Cyfip1 T A 7: 55,926,400 I1108N possibly damaging Het
Dnah14 A G 1: 181,797,734 D4060G probably damaging Het
Dpyd A G 3: 119,064,921 T595A probably damaging Het
Eps8 G A 6: 137,509,213 R434C possibly damaging Het
Fasl A G 1: 161,787,988 Y100H probably damaging Het
Fkbp9 A T 6: 56,849,727 N104I probably damaging Het
Frmd4a A G 2: 4,473,214 T65A possibly damaging Het
Gm1110 T C 9: 26,914,357 N102S probably damaging Het
Gm2381 T C 7: 42,822,380 Q25R possibly damaging Het
Gtpbp2 A G 17: 46,161,313 Y58C probably damaging Het
H2-T3 C A 17: 36,187,345 K269N probably damaging Het
Icosl C A 10: 78,073,873 Y217* probably null Het
Il17rd G T 14: 27,087,546 R153L probably benign Het
Kif17 C A 4: 138,298,306 T973K possibly damaging Het
Klk1b16 A G 7: 44,141,483 I236M probably benign Het
Lgmn G A 12: 102,423,739 probably benign Het
Lmbr1l T C 15: 98,913,587 D54G possibly damaging Het
Lrrc49 A T 9: 60,677,191 I196N possibly damaging Het
Maml1 C T 11: 50,266,449 A300T possibly damaging Het
Mapkap1 A T 2: 34,533,817 Q293L possibly damaging Het
Mki67 T C 7: 135,713,839 T69A probably benign Het
Mlph G A 1: 90,921,983 probably null Het
Myh1 A T 11: 67,220,609 M1625L probably benign Het
Myh3 G T 11: 67,091,021 R781L probably benign Het
Nckap5 A T 1: 126,026,049 I922K probably benign Het
Nlrp5 T A 7: 23,417,634 M261K probably damaging Het
Olfr1317 A T 2: 112,142,169 S75C possibly damaging Het
Olfr312 T A 11: 58,831,924 Y257N probably damaging Het
Olfr396-ps1 G A 11: 73,928,837 M204I probably benign Het
Olfr965 A G 9: 39,719,610 N128D probably benign Het
Pak1 T A 7: 97,888,972 V262E probably benign Het
Pigw A T 11: 84,877,104 D466E probably damaging Het
Pira2 A T 7: 3,844,345 L115Q probably damaging Het
Rbm15 A C 3: 107,333,116 probably benign Het
Rfx1 A G 8: 84,073,756 probably benign Het
Rfx7 A G 9: 72,593,357 Y133C probably damaging Het
Serpinb9d T A 13: 33,200,719 D226E probably benign Het
Sgk3 G A 1: 9,884,476 A271T possibly damaging Het
Sh2d5 T A 4: 138,256,839 C173S probably benign Het
Skint8 T C 4: 111,939,572 V291A probably benign Het
Slc22a27 T A 19: 7,926,689 N28Y probably benign Het
Slc25a54 G A 3: 109,116,435 V449I probably benign Het
Slc39a9 T C 12: 80,679,542 F255S probably damaging Het
Spata31d1c C T 13: 65,036,128 H495Y probably damaging Het
Stab2 G A 10: 86,969,185 Q310* probably null Het
Tenm3 A T 8: 48,236,177 M2125K possibly damaging Het
Tex2 G A 11: 106,548,859 T565M unknown Het
Tll1 G A 8: 64,025,142 A859V probably damaging Het
Tmem106c C T 15: 97,969,631 T232I possibly damaging Het
Tmem2 C A 19: 21,826,145 Y847* probably null Het
Trim65 T G 11: 116,128,290 D141A probably benign Het
Trim80 T C 11: 115,441,216 F78S probably damaging Het
Txnrd1 T A 10: 82,873,217 I83N probably benign Het
Vnn3 G A 10: 23,851,908 G72D probably benign Het
Wasl G T 6: 24,619,687 P278Q unknown Het
Wdr62 A T 7: 30,243,917 L951Q probably damaging Het
Zfp760 C T 17: 21,723,833 T663I unknown Het
Other mutations in Supt16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00950:Supt16 APN 14 52161798 missense possibly damaging 0.72
IGL00985:Supt16 APN 14 52161691 missense possibly damaging 0.53
IGL01160:Supt16 APN 14 52183132 missense probably benign
IGL01328:Supt16 APN 14 52177032 missense probably benign 0.20
IGL01329:Supt16 APN 14 52177032 missense probably benign 0.20
IGL01413:Supt16 APN 14 52177032 missense probably benign 0.20
IGL01414:Supt16 APN 14 52177032 missense probably benign 0.20
IGL01535:Supt16 APN 14 52177190 missense probably damaging 0.99
IGL01765:Supt16 APN 14 52180223 missense probably damaging 0.98
IGL01976:Supt16 APN 14 52182307 missense possibly damaging 0.70
IGL02422:Supt16 APN 14 52179543 missense possibly damaging 0.85
IGL02449:Supt16 APN 14 52173806 missense possibly damaging 0.92
IGL02516:Supt16 APN 14 52183964 missense possibly damaging 0.57
IGL02831:Supt16 APN 14 52170878 missense possibly damaging 0.70
IGL03112:Supt16 APN 14 52176398 missense probably damaging 0.98
IGL03406:Supt16 APN 14 52178141 missense possibly damaging 0.92
watercolor UTSW 14 52170881 missense probably damaging 0.96
R0332:Supt16 UTSW 14 52181157 missense probably damaging 0.99
R0385:Supt16 UTSW 14 52176718 missense probably benign 0.01
R0389:Supt16 UTSW 14 52174113 missense probably damaging 0.98
R0422:Supt16 UTSW 14 52183996 missense probably benign 0.26
R1101:Supt16 UTSW 14 52171439 missense probably null 0.81
R1212:Supt16 UTSW 14 52174124 nonsense probably null
R1487:Supt16 UTSW 14 52176608 critical splice donor site probably null
R1494:Supt16 UTSW 14 52172459 missense probably benign 0.01
R1566:Supt16 UTSW 14 52176655 missense probably damaging 0.99
R1652:Supt16 UTSW 14 52177180 missense probably benign 0.34
R1913:Supt16 UTSW 14 52178135 missense possibly damaging 0.84
R2220:Supt16 UTSW 14 52172144 nonsense probably null
R2344:Supt16 UTSW 14 52178118 missense probably benign 0.00
R3430:Supt16 UTSW 14 52175359 missense probably benign 0.05
R3746:Supt16 UTSW 14 52180139 missense probably damaging 0.99
R3749:Supt16 UTSW 14 52180139 missense probably damaging 0.99
R4010:Supt16 UTSW 14 52164441 missense probably damaging 1.00
R4108:Supt16 UTSW 14 52162731 missense probably damaging 1.00
R4109:Supt16 UTSW 14 52162731 missense probably damaging 1.00
R4597:Supt16 UTSW 14 52173589 missense probably damaging 1.00
R5117:Supt16 UTSW 14 52183092 missense probably damaging 1.00
R5309:Supt16 UTSW 14 52162698 missense probably damaging 1.00
R5695:Supt16 UTSW 14 52174144 splice site probably null
R5895:Supt16 UTSW 14 52164522 missense probably benign 0.17
R5941:Supt16 UTSW 14 52182196 missense probably benign
R5993:Supt16 UTSW 14 52178334 missense probably damaging 1.00
R6197:Supt16 UTSW 14 52170881 missense probably damaging 0.96
R6254:Supt16 UTSW 14 52170834 missense probably damaging 1.00
R6381:Supt16 UTSW 14 52179546 missense probably benign 0.02
R6667:Supt16 UTSW 14 52172063 missense probably damaging 1.00
R7000:Supt16 UTSW 14 52171450 missense probably damaging 0.97
R7063:Supt16 UTSW 14 52172048 missense possibly damaging 0.92
R7276:Supt16 UTSW 14 52177001 missense probably benign
R7344:Supt16 UTSW 14 52173571 missense probably damaging 0.98
R7384:Supt16 UTSW 14 52181162 missense probably damaging 0.99
R7411:Supt16 UTSW 14 52178051 missense probably damaging 1.00
R7586:Supt16 UTSW 14 52173556 missense probably damaging 0.97
R7633:Supt16 UTSW 14 52197099 missense probably benign 0.38
R8024:Supt16 UTSW 14 52170875 missense probably damaging 0.96
R8197:Supt16 UTSW 14 52174085 missense possibly damaging 0.95
R8201:Supt16 UTSW 14 52170990 missense probably damaging 1.00
R8285:Supt16 UTSW 14 52181083 missense possibly damaging 0.95
Z1177:Supt16 UTSW 14 52163285 missense possibly damaging 0.63
Z1177:Supt16 UTSW 14 52181537 missense probably null 0.21
Predicted Primers PCR Primer
(F):5'- CACTCAGTAGGGAGCATGTG -3'
(R):5'- CTCTGGTAGGTCTTGGGACATC -3'

Sequencing Primer
(F):5'- GCATGTGCTCAGCAGACTTG -3'
(R):5'- TCTTGGGACATCTGGCCTCAAAG -3'
Posted On2019-09-13