Incidental Mutation 'R7336:Lmbr1l'
ID 569531
Institutional Source Beutler Lab
Gene Symbol Lmbr1l
Ensembl Gene ENSMUSG00000022999
Gene Name limb region 1 like
Synonyms D15Ertd735e, 1110013E13Rik
MMRRC Submission 045426-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7336 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 98801798-98815944 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 98811468 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 54 (D54G)
Ref Sequence ENSEMBL: ENSMUSP00000023736 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023736]
AlphaFold Q9D1E5
Predicted Effect possibly damaging
Transcript: ENSMUST00000023736
AA Change: D54G

PolyPhen 2 Score 0.939 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000023736
Gene: ENSMUSG00000022999
AA Change: D54G

DomainStartEndE-ValueType
Pfam:LMBR1 28 269 2e-41 PFAM
Pfam:LMBR1 266 450 1.2e-35 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 99% (80/81)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene disruption display normal morphology, clinical chemistry, hematology, and behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl2fm1 G A 3: 59,840,174 (GRCm39) probably null Het
Abca15 A T 7: 119,987,456 (GRCm39) Q1247H possibly damaging Het
Acsf2 G C 11: 94,462,476 (GRCm39) Q180E probably benign Het
Adamts8 A G 9: 30,873,363 (GRCm39) D856G probably benign Het
Agrn A T 4: 156,259,371 (GRCm39) C828* probably null Het
Ankub1 T C 3: 57,573,108 (GRCm39) T205A probably benign Het
Atm A T 9: 53,373,803 (GRCm39) Y2150N possibly damaging Het
Barhl1 A G 2: 28,799,855 (GRCm39) F257L probably benign Het
Bcat2 T A 7: 45,224,909 (GRCm39) C27S probably benign Het
Bod1l G A 5: 41,978,867 (GRCm39) R816C probably damaging Het
Btg3 A G 16: 78,161,695 (GRCm39) Y172H probably benign Het
Cacna1d T C 14: 29,767,239 (GRCm39) D1940G probably benign Het
Catsperg2 T A 7: 29,406,026 (GRCm39) N624I possibly damaging Het
Ccdc146 A G 5: 21,508,110 (GRCm39) V646A probably benign Het
Ccp110 C T 7: 118,321,433 (GRCm39) P363S probably damaging Het
Cct4 C A 11: 22,951,564 (GRCm39) T377K possibly damaging Het
Cemip2 C A 19: 21,803,509 (GRCm39) Y847* probably null Het
Cep350 T A 1: 155,738,022 (GRCm39) H2607L probably benign Het
Cfap46 A G 7: 139,200,020 (GRCm39) F1954L unknown Het
Chat C T 14: 32,145,213 (GRCm39) probably null Het
Clasp2 A G 9: 113,705,421 (GRCm39) probably null Het
Cldn9 T C 17: 23,901,989 (GRCm39) D212G probably benign Het
Cp G A 3: 20,018,696 (GRCm39) probably null Het
Cyfip1 T A 7: 55,576,148 (GRCm39) I1108N possibly damaging Het
Dnah14 A G 1: 181,625,299 (GRCm39) D4060G probably damaging Het
Dpyd A G 3: 118,858,570 (GRCm39) T595A probably damaging Het
Eps8 G A 6: 137,486,211 (GRCm39) R434C possibly damaging Het
Fasl A G 1: 161,615,557 (GRCm39) Y100H probably damaging Het
Fkbp9 A T 6: 56,826,712 (GRCm39) N104I probably damaging Het
Frmd4a A G 2: 4,478,025 (GRCm39) T65A possibly damaging Het
Gm1110 T C 9: 26,825,653 (GRCm39) N102S probably damaging Het
Gm2381 T C 7: 42,471,804 (GRCm39) Q25R possibly damaging Het
Gtpbp2 A G 17: 46,472,239 (GRCm39) Y58C probably damaging Het
H2-T3 C A 17: 36,498,237 (GRCm39) K269N probably damaging Het
Icosl C A 10: 77,909,707 (GRCm39) Y217* probably null Het
Il17rd G T 14: 26,809,503 (GRCm39) R153L probably benign Het
Kif17 C A 4: 138,025,617 (GRCm39) T973K possibly damaging Het
Klk1b16 A G 7: 43,790,907 (GRCm39) I236M probably benign Het
Lgmn G A 12: 102,389,998 (GRCm39) probably benign Het
Lrrc49 A T 9: 60,584,474 (GRCm39) I196N possibly damaging Het
Maml1 C T 11: 50,157,276 (GRCm39) A300T possibly damaging Het
Mapkap1 A T 2: 34,423,829 (GRCm39) Q293L possibly damaging Het
Mki67 T C 7: 135,315,568 (GRCm39) T69A probably benign Het
Mlph G A 1: 90,849,705 (GRCm39) probably null Het
Myh1 A T 11: 67,111,435 (GRCm39) M1625L probably benign Het
Myh3 G T 11: 66,981,847 (GRCm39) R781L probably benign Het
Nckap5 A T 1: 125,953,786 (GRCm39) I922K probably benign Het
Nlrp5 T A 7: 23,117,059 (GRCm39) M261K probably damaging Het
Or1e1d-ps1 G A 11: 73,819,663 (GRCm39) M204I probably benign Het
Or4f47 A T 2: 111,972,514 (GRCm39) S75C possibly damaging Het
Or5af1 T A 11: 58,722,750 (GRCm39) Y257N probably damaging Het
Or8g52 A G 9: 39,630,906 (GRCm39) N128D probably benign Het
Pak1 T A 7: 97,538,179 (GRCm39) V262E probably benign Het
Pigw A T 11: 84,767,930 (GRCm39) D466E probably damaging Het
Pira2 A T 7: 3,847,344 (GRCm39) L115Q probably damaging Het
Rbm15 A C 3: 107,240,432 (GRCm39) probably benign Het
Rfx1 A G 8: 84,800,385 (GRCm39) probably benign Het
Rfx7 A G 9: 72,500,639 (GRCm39) Y133C probably damaging Het
Serpinb9d T A 13: 33,384,702 (GRCm39) D226E probably benign Het
Sgk3 G A 1: 9,954,701 (GRCm39) A271T possibly damaging Het
Sh2d5 T A 4: 137,984,150 (GRCm39) C173S probably benign Het
Skint8 T C 4: 111,796,769 (GRCm39) V291A probably benign Het
Slc22a27 T A 19: 7,904,054 (GRCm39) N28Y probably benign Het
Slc25a54 G A 3: 109,023,751 (GRCm39) V449I probably benign Het
Slc39a9 T C 12: 80,726,316 (GRCm39) F255S probably damaging Het
Spata31d1c C T 13: 65,183,942 (GRCm39) H495Y probably damaging Het
Stab2 G A 10: 86,805,049 (GRCm39) Q310* probably null Het
Supt16 C A 14: 52,408,948 (GRCm39) A809S possibly damaging Het
Tenm3 A T 8: 48,689,212 (GRCm39) M2125K possibly damaging Het
Tex2 G A 11: 106,439,685 (GRCm39) T565M unknown Het
Tll1 G A 8: 64,478,176 (GRCm39) A859V probably damaging Het
Tmem106c C T 15: 97,867,512 (GRCm39) T232I possibly damaging Het
Trim65 T G 11: 116,019,116 (GRCm39) D141A probably benign Het
Trim80 T C 11: 115,332,042 (GRCm39) F78S probably damaging Het
Txnrd1 T A 10: 82,709,051 (GRCm39) I83N probably benign Het
Vnn3 G A 10: 23,727,806 (GRCm39) G72D probably benign Het
Wasl G T 6: 24,619,686 (GRCm39) P278Q unknown Het
Wdr62 A T 7: 29,943,342 (GRCm39) L951Q probably damaging Het
Zfp760 C T 17: 21,942,814 (GRCm39) T663I unknown Het
Other mutations in Lmbr1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02002:Lmbr1l APN 15 98,802,666 (GRCm39) missense probably damaging 1.00
IGL02097:Lmbr1l APN 15 98,815,772 (GRCm39) missense probably damaging 0.98
IGL02731:Lmbr1l APN 15 98,815,777 (GRCm39) missense probably damaging 0.96
finch UTSW 15 98,807,267 (GRCm39) critical splice donor site probably null
Gooseberry UTSW 15 98,810,308 (GRCm39) missense probably damaging 0.99
junco UTSW 15 98,810,408 (GRCm39) missense probably damaging 1.00
morula UTSW 15 98,802,672 (GRCm39) missense probably damaging 1.00
munia UTSW 15 98,807,150 (GRCm39) critical splice acceptor site probably null
strawberry UTSW 15 98,807,144 (GRCm39) nonsense probably null
R0310:Lmbr1l UTSW 15 98,806,654 (GRCm39) splice site probably benign
R1778:Lmbr1l UTSW 15 98,810,357 (GRCm39) missense probably damaging 1.00
R2418:Lmbr1l UTSW 15 98,805,418 (GRCm39) missense possibly damaging 0.89
R2419:Lmbr1l UTSW 15 98,805,418 (GRCm39) missense possibly damaging 0.89
R4181:Lmbr1l UTSW 15 98,806,601 (GRCm39) missense possibly damaging 0.94
R4379:Lmbr1l UTSW 15 98,807,144 (GRCm39) nonsense probably null
R4472:Lmbr1l UTSW 15 98,804,178 (GRCm39) missense probably benign 0.02
R5290:Lmbr1l UTSW 15 98,810,123 (GRCm39) missense probably damaging 1.00
R5410:Lmbr1l UTSW 15 98,807,143 (GRCm39) missense probably damaging 1.00
R5436:Lmbr1l UTSW 15 98,802,672 (GRCm39) missense probably damaging 1.00
R5667:Lmbr1l UTSW 15 98,805,489 (GRCm39) missense possibly damaging 0.88
R5671:Lmbr1l UTSW 15 98,805,489 (GRCm39) missense possibly damaging 0.88
R5918:Lmbr1l UTSW 15 98,810,308 (GRCm39) missense probably damaging 0.99
R6735:Lmbr1l UTSW 15 98,807,121 (GRCm39) missense probably damaging 1.00
R6882:Lmbr1l UTSW 15 98,805,467 (GRCm39) missense probably damaging 0.99
R7131:Lmbr1l UTSW 15 98,804,204 (GRCm39) missense probably benign 0.05
R7136:Lmbr1l UTSW 15 98,809,372 (GRCm39) splice site probably null
R7169:Lmbr1l UTSW 15 98,807,075 (GRCm39) critical splice donor site probably benign
R7169:Lmbr1l UTSW 15 98,807,039 (GRCm39) frame shift probably null
R7541:Lmbr1l UTSW 15 98,807,267 (GRCm39) critical splice donor site probably null
R7603:Lmbr1l UTSW 15 98,806,572 (GRCm39) nonsense probably null
R7974:Lmbr1l UTSW 15 98,809,500 (GRCm39) missense probably benign 0.03
R8354:Lmbr1l UTSW 15 98,810,357 (GRCm39) missense probably damaging 1.00
R8454:Lmbr1l UTSW 15 98,810,357 (GRCm39) missense probably damaging 1.00
R8504:Lmbr1l UTSW 15 98,810,065 (GRCm39) missense probably damaging 0.97
R8933:Lmbr1l UTSW 15 98,807,150 (GRCm39) critical splice acceptor site probably null
R8974:Lmbr1l UTSW 15 98,810,408 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGAACAGCAGCTTTCCTAG -3'
(R):5'- ATTCTGTGTAATGGTCGAGGAC -3'

Sequencing Primer
(F):5'- TTCCTAGCATCCCCGGGATAAG -3'
(R):5'- TCGAGGACCCCTGATCAC -3'
Posted On 2019-09-13