Incidental Mutation 'R7336:Zfp760'
ID569533
Institutional Source Beutler Lab
Gene Symbol Zfp760
Ensembl Gene ENSMUSG00000067928
Gene Namezinc finger protein 760
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R7336 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location21707741-21725636 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 21723833 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 663 (T663I)
Ref Sequence ENSEMBL: ENSMUSP00000073038 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073312]
Predicted Effect unknown
Transcript: ENSMUST00000073312
AA Change: T663I
SMART Domains Protein: ENSMUSP00000073038
Gene: ENSMUSG00000067928
AA Change: T663I

DomainStartEndE-ValueType
KRAB 8 69 3.62e-21 SMART
ZnF_C2H2 183 202 1.78e2 SMART
ZnF_C2H2 208 230 1.69e-3 SMART
ZnF_C2H2 236 258 4.54e-4 SMART
ZnF_C2H2 264 286 2.79e-4 SMART
ZnF_C2H2 292 314 1.1e-2 SMART
ZnF_C2H2 320 342 2.71e-2 SMART
ZnF_C2H2 348 370 7.9e-4 SMART
ZnF_C2H2 376 398 1.72e-4 SMART
ZnF_C2H2 404 426 1.14e0 SMART
ZnF_C2H2 432 454 4.05e-1 SMART
ZnF_C2H2 460 482 5.14e-3 SMART
ZnF_C2H2 488 510 1.18e-2 SMART
ZnF_C2H2 516 538 1.95e-3 SMART
ZnF_C2H2 544 566 1.82e-3 SMART
ZnF_C2H2 572 594 4.17e-3 SMART
ZnF_C2H2 600 622 1.04e-3 SMART
ZnF_C2H2 628 650 1.28e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 99% (80/81)
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 A T 7: 120,388,233 Q1247H possibly damaging Het
Acsf2 G C 11: 94,571,650 Q180E probably benign Het
Adamts8 A G 9: 30,962,067 D856G probably benign Het
Agrn A T 4: 156,174,914 C828* probably null Het
Ankub1 T C 3: 57,665,687 T205A probably benign Het
Atm A T 9: 53,462,503 Y2150N possibly damaging Het
Barhl1 A G 2: 28,909,843 F257L probably benign Het
Bcat2 T A 7: 45,575,485 C27S probably benign Het
Bod1l G A 5: 41,821,524 R816C probably damaging Het
Btg3 A G 16: 78,364,807 Y172H probably benign Het
C130079G13Rik G A 3: 59,932,753 probably null Het
Cacna1d T C 14: 30,045,282 D1940G probably benign Het
Catsperg2 T A 7: 29,706,601 N624I possibly damaging Het
Ccdc146 A G 5: 21,303,112 V646A probably benign Het
Ccp110 C T 7: 118,722,210 P363S probably damaging Het
Cct4 C A 11: 23,001,564 T377K possibly damaging Het
Cep350 T A 1: 155,862,276 H2607L probably benign Het
Cfap46 A G 7: 139,620,104 F1954L unknown Het
Chat C T 14: 32,423,256 probably null Het
Clasp2 A G 9: 113,876,353 probably null Het
Cldn9 T C 17: 23,683,015 D212G probably benign Het
Cp G A 3: 19,964,532 probably null Het
Cyfip1 T A 7: 55,926,400 I1108N possibly damaging Het
Dnah14 A G 1: 181,797,734 D4060G probably damaging Het
Dpyd A G 3: 119,064,921 T595A probably damaging Het
Eps8 G A 6: 137,509,213 R434C possibly damaging Het
Fasl A G 1: 161,787,988 Y100H probably damaging Het
Fkbp9 A T 6: 56,849,727 N104I probably damaging Het
Frmd4a A G 2: 4,473,214 T65A possibly damaging Het
Gm1110 T C 9: 26,914,357 N102S probably damaging Het
Gm2381 T C 7: 42,822,380 Q25R possibly damaging Het
Gtpbp2 A G 17: 46,161,313 Y58C probably damaging Het
H2-T3 C A 17: 36,187,345 K269N probably damaging Het
Icosl C A 10: 78,073,873 Y217* probably null Het
Il17rd G T 14: 27,087,546 R153L probably benign Het
Kif17 C A 4: 138,298,306 T973K possibly damaging Het
Klk1b16 A G 7: 44,141,483 I236M probably benign Het
Lgmn G A 12: 102,423,739 probably benign Het
Lmbr1l T C 15: 98,913,587 D54G possibly damaging Het
Lrrc49 A T 9: 60,677,191 I196N possibly damaging Het
Maml1 C T 11: 50,266,449 A300T possibly damaging Het
Mapkap1 A T 2: 34,533,817 Q293L possibly damaging Het
Mki67 T C 7: 135,713,839 T69A probably benign Het
Mlph G A 1: 90,921,983 probably null Het
Myh1 A T 11: 67,220,609 M1625L probably benign Het
Myh3 G T 11: 67,091,021 R781L probably benign Het
Nckap5 A T 1: 126,026,049 I922K probably benign Het
Nlrp5 T A 7: 23,417,634 M261K probably damaging Het
Olfr1317 A T 2: 112,142,169 S75C possibly damaging Het
Olfr312 T A 11: 58,831,924 Y257N probably damaging Het
Olfr396-ps1 G A 11: 73,928,837 M204I probably benign Het
Olfr965 A G 9: 39,719,610 N128D probably benign Het
Pak1 T A 7: 97,888,972 V262E probably benign Het
Pigw A T 11: 84,877,104 D466E probably damaging Het
Pira2 A T 7: 3,844,345 L115Q probably damaging Het
Rbm15 A C 3: 107,333,116 probably benign Het
Rfx1 A G 8: 84,073,756 probably benign Het
Rfx7 A G 9: 72,593,357 Y133C probably damaging Het
Serpinb9d T A 13: 33,200,719 D226E probably benign Het
Sgk3 G A 1: 9,884,476 A271T possibly damaging Het
Sh2d5 T A 4: 138,256,839 C173S probably benign Het
Skint8 T C 4: 111,939,572 V291A probably benign Het
Slc22a27 T A 19: 7,926,689 N28Y probably benign Het
Slc25a54 G A 3: 109,116,435 V449I probably benign Het
Slc39a9 T C 12: 80,679,542 F255S probably damaging Het
Spata31d1c C T 13: 65,036,128 H495Y probably damaging Het
Stab2 G A 10: 86,969,185 Q310* probably null Het
Supt16 C A 14: 52,171,491 A809S possibly damaging Het
Tenm3 A T 8: 48,236,177 M2125K possibly damaging Het
Tex2 G A 11: 106,548,859 T565M unknown Het
Tll1 G A 8: 64,025,142 A859V probably damaging Het
Tmem106c C T 15: 97,969,631 T232I possibly damaging Het
Tmem2 C A 19: 21,826,145 Y847* probably null Het
Trim65 T G 11: 116,128,290 D141A probably benign Het
Trim80 T C 11: 115,441,216 F78S probably damaging Het
Txnrd1 T A 10: 82,873,217 I83N probably benign Het
Vnn3 G A 10: 23,851,908 G72D probably benign Het
Wasl G T 6: 24,619,687 P278Q unknown Het
Wdr62 A T 7: 30,243,917 L951Q probably damaging Het
Other mutations in Zfp760
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00472:Zfp760 APN 17 21723476 missense possibly damaging 0.75
IGL00862:Zfp760 APN 17 21722284 missense probably benign 0.00
IGL02198:Zfp760 APN 17 21722212 missense probably benign 0.00
R0478:Zfp760 UTSW 17 21722014 nonsense probably null
R0835:Zfp760 UTSW 17 21723578 missense possibly damaging 0.63
R1191:Zfp760 UTSW 17 21723305 missense probably damaging 1.00
R1760:Zfp760 UTSW 17 21722330 missense probably damaging 1.00
R2698:Zfp760 UTSW 17 21720954 missense probably damaging 0.99
R3722:Zfp760 UTSW 17 21722162 missense probably damaging 1.00
R4561:Zfp760 UTSW 17 21723667 missense probably benign 0.00
R4700:Zfp760 UTSW 17 21722407 missense probably benign 0.01
R4859:Zfp760 UTSW 17 21723530 missense probably damaging 0.97
R4859:Zfp760 UTSW 17 21723535 nonsense probably null
R4897:Zfp760 UTSW 17 21723248 missense probably benign 0.02
R6675:Zfp760 UTSW 17 21723010 missense possibly damaging 0.92
R7286:Zfp760 UTSW 17 21722779 missense probably benign 0.04
R7356:Zfp760 UTSW 17 21722620 missense probably benign
R7369:Zfp760 UTSW 17 21723233 missense probably benign 0.00
R7504:Zfp760 UTSW 17 21722674 missense probably damaging 0.97
R7553:Zfp760 UTSW 17 21722891 missense possibly damaging 0.82
X0057:Zfp760 UTSW 17 21723682 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- AAATCCTTTACCCACTGCTCAAGTC -3'
(R):5'- CAATGCATATCATGGGTTTTCTAGC -3'

Sequencing Primer
(F):5'- CTCATCAGAAAATTCATGCTGGGG -3'
(R):5'- CATGGGTTTTCTAGCATGGAATTTC -3'
Posted On2019-09-13