Incidental Mutation 'R7337:Cyp27a1'
ID 569541
Institutional Source Beutler Lab
Gene Symbol Cyp27a1
Ensembl Gene ENSMUSG00000026170
Gene Name cytochrome P450, family 27, subfamily a, polypeptide 1
Synonyms cholesterol 27 hydroxylase, Cyp27, 1300013A03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock # R7337 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 74713574-74737892 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 74735435 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 204 (V204E)
Ref Sequence ENSEMBL: ENSMUSP00000027356 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027356] [ENSMUST00000081636] [ENSMUST00000113672] [ENSMUST00000160732] [ENSMUST00000188073]
AlphaFold Q9DBG1
Predicted Effect probably damaging
Transcript: ENSMUST00000027356
AA Change: V204E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027356
Gene: ENSMUSG00000026170
AA Change: V204E

DomainStartEndE-ValueType
Pfam:p450 63 529 5.1e-107 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000081636
SMART Domains Protein: ENSMUSP00000080342
Gene: ENSMUSG00000006542

DomainStartEndE-ValueType
low complexity region 63 77 N/A INTRINSIC
CBS 202 251 2.66e-6 SMART
CBS 283 332 7.57e-11 SMART
CBS 358 406 8.69e-11 SMART
CBS 430 478 3.73e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113672
SMART Domains Protein: ENSMUSP00000109302
Gene: ENSMUSG00000006542

DomainStartEndE-ValueType
low complexity region 38 52 N/A INTRINSIC
CBS 177 226 2.66e-6 SMART
CBS 258 307 7.57e-11 SMART
CBS 333 381 8.69e-11 SMART
CBS 405 453 3.73e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160732
SMART Domains Protein: ENSMUSP00000125344
Gene: ENSMUSG00000006542

DomainStartEndE-ValueType
low complexity region 63 77 N/A INTRINSIC
CBS 202 251 2.66e-6 SMART
CBS 283 332 7.57e-11 SMART
CBS 358 406 8.69e-11 SMART
CBS 430 478 3.73e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000188073
SMART Domains Protein: ENSMUSP00000139909
Gene: ENSMUSG00000006542

DomainStartEndE-ValueType
low complexity region 63 77 N/A INTRINSIC
CBS 202 251 2.66e-6 SMART
CBS 283 332 7.57e-11 SMART
CBS 358 406 8.69e-11 SMART
CBS 430 478 3.73e-10 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (88/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This mitochondrial protein oxidizes cholesterol intermediates as part of the bile synthesis pathway. Since the conversion of cholesterol to bile acids is the major route for removing cholesterol from the body, this protein is important for overall cholesterol homeostasis. Mutations in this gene cause cerebrotendinous xanthomatosis, a rare autosomal recessive lipid storage disease. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null allele show hepato- and adrenomegaly, reduced bile acid synthesis, increased cholesterol 7alpha-hydroxylase activity and 7alpha-hydroxycholesterol levels, slightly higher 25-hydroxyvitamin D levels, and altered hepatic fatty acid, triacylglycerol, and adrenal cholesterol homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011H14Rik A G 14: 49,234,491 M163T possibly damaging Het
Abcb11 A T 2: 69,245,769 H1198Q probably damaging Het
Adamts14 A G 10: 61,207,460 V743A probably damaging Het
Adgrg6 A G 10: 14,467,351 V284A possibly damaging Het
AI314180 T C 4: 58,827,047 T1029A possibly damaging Het
Alb A G 5: 90,474,593 K560R probably damaging Het
Aqp9 A T 9: 71,162,482 F8L probably benign Het
Arhgef7 T C 8: 11,785,789 L182P probably damaging Het
Atr A G 9: 95,871,448 D701G probably damaging Het
Calr3 C T 8: 72,431,495 D187N probably damaging Het
Ccdc65 A G 15: 98,721,096 T319A probably benign Het
Ccdc66 A T 14: 27,500,333 L151H probably damaging Het
Ces2e T A 8: 104,931,056 probably null Het
Cfap46 A G 7: 139,630,576 probably null Het
Cfap74 A G 4: 155,460,015 T1034A unknown Het
Cldnd1 T G 16: 58,728,959 probably null Het
Clec4f C A 6: 83,653,208 V123L probably benign Het
Cntn6 C T 6: 104,650,530 T108I probably damaging Het
Crygn T G 5: 24,756,149 D53A possibly damaging Het
Cyp2c67 A T 19: 39,609,264 probably null Het
Ddb1 T C 19: 10,627,831 V1061A possibly damaging Het
Dnah12 G T 14: 26,766,577 probably null Het
Draxin T C 4: 148,112,759 T194A probably benign Het
Drosha T A 15: 12,846,199 D473E possibly damaging Het
G6pd2 T A 5: 61,810,219 C446S probably benign Het
Gm29106 C T 1: 118,176,912 S3L unknown Het
Grin3a T C 4: 49,702,762 Y908C probably damaging Het
Ints2 G A 11: 86,217,842 A893V probably benign Het
Ippk C T 13: 49,449,291 T371I probably benign Het
Irf2 T A 8: 46,807,281 C83S probably damaging Het
Jph3 C T 8: 121,753,702 A373V probably benign Het
Kcnj6 C T 16: 94,833,214 V13I probably benign Het
Lama3 T C 18: 12,507,040 probably null Het
Lmo7 A T 14: 101,884,204 Q235L probably damaging Het
March7 A G 2: 60,240,845 probably null Het
Mfsd6l A T 11: 68,557,283 Y320F possibly damaging Het
Mroh1 T A 15: 76,451,476 W1440R probably benign Het
Mrps17 G A 5: 129,716,799 G19D probably damaging Het
Myt1 A G 2: 181,802,963 H566R possibly damaging Het
Nav2 T C 7: 49,551,773 L176P possibly damaging Het
Nop58 T A 1: 59,698,440 C139S probably benign Het
Nsd1 A G 13: 55,246,209 D644G probably damaging Het
Nsd2 T A 5: 33,885,472 C1027S probably damaging Het
Nsmce2 A G 15: 59,601,416 I235V probably damaging Het
Nyap2 T C 1: 81,336,515 V642A possibly damaging Het
Olfr300-ps1 A T 7: 86,443,120 L46F unknown Het
Olfr919 A G 9: 38,697,865 V167A probably benign Het
Paqr7 A G 4: 134,507,120 D96G probably benign Het
Parp4 A G 14: 56,602,395 Y520C probably damaging Het
Pde5a A G 3: 122,748,458 N199S probably damaging Het
Piezo1 A T 8: 122,485,724 Y1955N Het
Pnmal1 A G 7: 16,961,390 K390R probably benign Het
Prdm10 G T 9: 31,316,241 Q47H probably damaging Het
Psg22 T A 7: 18,719,574 F104I probably benign Het
Ptprf T C 4: 118,211,125 E1738G probably damaging Het
Rad21l A T 2: 151,658,445 L218Q probably damaging Het
Rad54l2 A G 9: 106,705,825 I798T probably damaging Het
Rgs5 G T 1: 169,655,580 M1I probably null Het
Rhbdl2 T C 4: 123,817,866 V132A possibly damaging Het
Rmi1 T A 13: 58,409,579 Y547* probably null Het
Rptn A T 3: 93,396,905 D515V probably benign Het
Rsph10b A G 5: 143,961,215 N505D probably benign Het
Samhd1 T C 2: 157,106,244 D539G probably damaging Het
Scube3 A T 17: 28,168,182 I885F probably damaging Het
Sfmbt1 A G 14: 30,784,739 I247V possibly damaging Het
Slc25a21 T C 12: 56,858,043 I62V probably benign Het
Slc4a11 T A 2: 130,685,532 N648Y probably damaging Het
Slc7a11 A G 3: 50,442,999 V88A possibly damaging Het
Slc7a8 A C 14: 54,726,806 F397V possibly damaging Het
Sox12 A C 2: 152,397,457 L81R probably damaging Het
Spg11 T C 2: 122,084,993 I1057V probably benign Het
St8sia3 G A 18: 64,269,916 V265I probably benign Het
Stxbp5 A G 10: 9,809,130 S509P possibly damaging Het
Svep1 T C 4: 58,108,323 Y1129C probably damaging Het
Tenm4 G T 7: 96,874,126 R1625L probably benign Het
Tlr4 T C 4: 66,839,954 F328S possibly damaging Het
Tmprss15 T C 16: 79,071,276 T215A probably benign Het
Tmprss9 A T 10: 80,882,670 I62L probably benign Het
Trpm5 C T 7: 143,089,019 A64T probably benign Het
Txk A C 5: 72,731,766 Y148* probably null Het
Uba5 C T 9: 104,055,255 G170R possibly damaging Het
Uggt2 A T 14: 119,086,175 D231E probably benign Het
Ulk4 A T 9: 121,248,927 D525E probably benign Het
Vmn1r158 T A 7: 22,790,224 T187S probably benign Het
Vmn1r52 T A 6: 90,179,623 M303K probably benign Het
Vmn2r54 A G 7: 12,622,117 F454S probably benign Het
Zbp1 A T 2: 173,218,753 L8* probably null Het
Zmym2 A T 14: 56,944,100 D924V probably benign Het
Other mutations in Cyp27a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01089:Cyp27a1 APN 1 74731938 missense possibly damaging 0.88
IGL01824:Cyp27a1 APN 1 74735881 nonsense probably null
IGL02725:Cyp27a1 APN 1 74735703 missense probably damaging 0.98
IGL02966:Cyp27a1 APN 1 74732090 missense probably benign
IGL03067:Cyp27a1 APN 1 74731909 splice site probably null
R0103:Cyp27a1 UTSW 1 74735915 missense probably benign
R0103:Cyp27a1 UTSW 1 74735915 missense probably benign
R1968:Cyp27a1 UTSW 1 74737276 missense probably benign 0.00
R2271:Cyp27a1 UTSW 1 74736687 missense probably damaging 1.00
R3847:Cyp27a1 UTSW 1 74737559 missense probably damaging 0.99
R4735:Cyp27a1 UTSW 1 74737207 missense possibly damaging 0.94
R4936:Cyp27a1 UTSW 1 74735405 missense probably benign 0.35
R5849:Cyp27a1 UTSW 1 74736684 missense probably damaging 1.00
R6129:Cyp27a1 UTSW 1 74735692 missense probably benign 0.24
R6193:Cyp27a1 UTSW 1 74737072 missense probably benign 0.00
R6344:Cyp27a1 UTSW 1 74736849 critical splice donor site probably null
R6464:Cyp27a1 UTSW 1 74735888 missense possibly damaging 0.61
R7226:Cyp27a1 UTSW 1 74737348 missense probably damaging 1.00
R7696:Cyp27a1 UTSW 1 74732039 missense probably benign 0.00
R7959:Cyp27a1 UTSW 1 74737077 missense probably benign 0.07
R8258:Cyp27a1 UTSW 1 74732055 missense probably benign 0.22
R8259:Cyp27a1 UTSW 1 74732055 missense probably benign 0.22
R9352:Cyp27a1 UTSW 1 74713761 missense possibly damaging 0.92
Z1177:Cyp27a1 UTSW 1 74737335 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACCCCATGCTTACTTGTGC -3'
(R):5'- ACAGATCTGATGAAGGCGGC -3'

Sequencing Primer
(F):5'- CATGCTTACTTGTGCCGTTCTTGG -3'
(R):5'- GGCAGTGTCCTCAGGAATG -3'
Posted On 2019-09-13