Incidental Mutation 'R7337:Nyap2'
ID 569542
Institutional Source Beutler Lab
Gene Symbol Nyap2
Ensembl Gene ENSMUSG00000054976
Gene Name neuronal tyrosine-phophorylated phosphoinositide 3-kinase adaptor 2
Synonyms Jr6, 9430031J16Rik
MMRRC Submission 045427-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7337 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 81054667-81319479 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 81314230 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 642 (V642A)
Ref Sequence ENSEMBL: ENSMUSP00000122935 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000123285]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000123285
AA Change: V642A

PolyPhen 2 Score 0.496 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000122935
Gene: ENSMUSG00000054976
AA Change: V642A

DomainStartEndE-ValueType
Pfam:NYAP_N 43 416 1.9e-134 PFAM
Pfam:NYAP_C 420 716 6.3e-46 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (88/88)
MGI Phenotype PHENOTYPE: Triple KO of Nyap1, Nyap2 and Myo16 results in decreased brain weight and cortex and striatum size and reduced neurite length in cortical neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 A T 2: 69,076,113 (GRCm39) H1198Q probably damaging Het
Adamts14 A G 10: 61,043,239 (GRCm39) V743A probably damaging Het
Adgrg6 A G 10: 14,343,095 (GRCm39) V284A possibly damaging Het
Alb A G 5: 90,622,452 (GRCm39) K560R probably damaging Het
Aqp9 A T 9: 71,069,764 (GRCm39) F8L probably benign Het
Arhgef7 T C 8: 11,835,789 (GRCm39) L182P probably damaging Het
Atr A G 9: 95,753,501 (GRCm39) D701G probably damaging Het
Calr3 C T 8: 73,185,339 (GRCm39) D187N probably damaging Het
Ccdc198 A G 14: 49,471,948 (GRCm39) M163T possibly damaging Het
Ccdc65 A G 15: 98,618,977 (GRCm39) T319A probably benign Het
Ccdc66 A T 14: 27,222,290 (GRCm39) L151H probably damaging Het
Ces2e T A 8: 105,657,688 (GRCm39) probably null Het
Cfap46 A G 7: 139,210,492 (GRCm39) probably null Het
Cfap74 A G 4: 155,544,472 (GRCm39) T1034A unknown Het
Cldnd1 T G 16: 58,549,322 (GRCm39) probably null Het
Clec4f C A 6: 83,630,190 (GRCm39) V123L probably benign Het
Cntn6 C T 6: 104,627,491 (GRCm39) T108I probably damaging Het
Crygn T G 5: 24,961,147 (GRCm39) D53A possibly damaging Het
Cyp27a1 T A 1: 74,774,594 (GRCm39) V204E probably damaging Het
Cyp2c67 A T 19: 39,597,708 (GRCm39) probably null Het
Ddb1 T C 19: 10,605,195 (GRCm39) V1061A possibly damaging Het
Dnah12 G T 14: 26,488,534 (GRCm39) probably null Het
Draxin T C 4: 148,197,216 (GRCm39) T194A probably benign Het
Drosha T A 15: 12,846,285 (GRCm39) D473E possibly damaging Het
Ecpas T C 4: 58,827,047 (GRCm39) T1029A possibly damaging Het
G6pd2 T A 5: 61,967,562 (GRCm39) C446S probably benign Het
Gm29106 C T 1: 118,104,642 (GRCm39) S3L unknown Het
Grin3a T C 4: 49,702,762 (GRCm39) Y908C probably damaging Het
Ints2 G A 11: 86,108,668 (GRCm39) A893V probably benign Het
Ippk C T 13: 49,602,767 (GRCm39) T371I probably benign Het
Irf2 T A 8: 47,260,316 (GRCm39) C83S probably damaging Het
Jph3 C T 8: 122,480,441 (GRCm39) A373V probably benign Het
Kcnj6 C T 16: 94,634,073 (GRCm39) V13I probably benign Het
Lama3 T C 18: 12,640,097 (GRCm39) probably null Het
Lmo7 A T 14: 102,121,640 (GRCm39) Q235L probably damaging Het
Marchf7 A G 2: 60,071,189 (GRCm39) probably null Het
Mfsd6l A T 11: 68,448,109 (GRCm39) Y320F possibly damaging Het
Mroh1 T A 15: 76,335,676 (GRCm39) W1440R probably benign Het
Mrps17 G A 5: 129,793,863 (GRCm39) G19D probably damaging Het
Myt1 A G 2: 181,444,756 (GRCm39) H566R possibly damaging Het
Nav2 T C 7: 49,201,521 (GRCm39) L176P possibly damaging Het
Nop58 T A 1: 59,737,599 (GRCm39) C139S probably benign Het
Nsd1 A G 13: 55,394,022 (GRCm39) D644G probably damaging Het
Nsd2 T A 5: 34,042,816 (GRCm39) C1027S probably damaging Het
Nsmce2 A G 15: 59,473,265 (GRCm39) I235V probably damaging Het
Or14n1-ps1 A T 7: 86,092,328 (GRCm39) L46F unknown Het
Or8g51 A G 9: 38,609,161 (GRCm39) V167A probably benign Het
Paqr7 A G 4: 134,234,431 (GRCm39) D96G probably benign Het
Parp4 A G 14: 56,839,852 (GRCm39) Y520C probably damaging Het
Pde5a A G 3: 122,542,107 (GRCm39) N199S probably damaging Het
Piezo1 A T 8: 123,212,463 (GRCm39) Y1955N Het
Pnma8a A G 7: 16,695,315 (GRCm39) K390R probably benign Het
Prdm10 G T 9: 31,227,537 (GRCm39) Q47H probably damaging Het
Psg22 T A 7: 18,453,499 (GRCm39) F104I probably benign Het
Ptprf T C 4: 118,068,322 (GRCm39) E1738G probably damaging Het
Rad21l A T 2: 151,500,365 (GRCm39) L218Q probably damaging Het
Rad54l2 A G 9: 106,583,024 (GRCm39) I798T probably damaging Het
Rgs5 G T 1: 169,483,149 (GRCm39) M1I probably null Het
Rhbdl2 T C 4: 123,711,659 (GRCm39) V132A possibly damaging Het
Rmi1 T A 13: 58,557,393 (GRCm39) Y547* probably null Het
Rptn A T 3: 93,304,212 (GRCm39) D515V probably benign Het
Rsph10b A G 5: 143,898,033 (GRCm39) N505D probably benign Het
Samhd1 T C 2: 156,948,164 (GRCm39) D539G probably damaging Het
Scube3 A T 17: 28,387,156 (GRCm39) I885F probably damaging Het
Sfmbt1 A G 14: 30,506,696 (GRCm39) I247V possibly damaging Het
Slc25a21 T C 12: 56,904,828 (GRCm39) I62V probably benign Het
Slc4a11 T A 2: 130,527,452 (GRCm39) N648Y probably damaging Het
Slc7a11 A G 3: 50,397,448 (GRCm39) V88A possibly damaging Het
Slc7a8 A C 14: 54,964,263 (GRCm39) F397V possibly damaging Het
Sox12 A C 2: 152,239,377 (GRCm39) L81R probably damaging Het
Spg11 T C 2: 121,915,474 (GRCm39) I1057V probably benign Het
St8sia3 G A 18: 64,402,987 (GRCm39) V265I probably benign Het
Stxbp5 A G 10: 9,684,874 (GRCm39) S509P possibly damaging Het
Svep1 T C 4: 58,108,323 (GRCm39) Y1129C probably damaging Het
Tenm4 G T 7: 96,523,333 (GRCm39) R1625L probably benign Het
Tlr4 T C 4: 66,758,191 (GRCm39) F328S possibly damaging Het
Tmprss15 T C 16: 78,868,164 (GRCm39) T215A probably benign Het
Tmprss9 A T 10: 80,718,504 (GRCm39) I62L probably benign Het
Trpm5 C T 7: 142,642,756 (GRCm39) A64T probably benign Het
Txk A C 5: 72,889,109 (GRCm39) Y148* probably null Het
Uba5 C T 9: 103,932,454 (GRCm39) G170R possibly damaging Het
Uggt2 A T 14: 119,323,587 (GRCm39) D231E probably benign Het
Ulk4 A T 9: 121,077,993 (GRCm39) D525E probably benign Het
Vmn1r158 T A 7: 22,489,649 (GRCm39) T187S probably benign Het
Vmn1r52 T A 6: 90,156,605 (GRCm39) M303K probably benign Het
Vmn2r54 A G 7: 12,356,044 (GRCm39) F454S probably benign Het
Zbp1 A T 2: 173,060,546 (GRCm39) L8* probably null Het
Zmym2 A T 14: 57,181,557 (GRCm39) D924V probably benign Het
Other mutations in Nyap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00466:Nyap2 APN 1 81,169,695 (GRCm39) missense probably damaging 0.99
IGL01660:Nyap2 APN 1 81,169,642 (GRCm39) missense probably damaging 0.99
IGL02379:Nyap2 APN 1 81,065,147 (GRCm39) missense probably damaging 1.00
IGL02652:Nyap2 APN 1 81,219,435 (GRCm39) missense probably damaging 1.00
IGL03217:Nyap2 APN 1 81,065,039 (GRCm39) missense probably damaging 1.00
IGL03410:Nyap2 APN 1 81,219,156 (GRCm39) missense possibly damaging 0.95
R0001:Nyap2 UTSW 1 81,169,822 (GRCm39) missense probably benign 0.03
R0014:Nyap2 UTSW 1 81,219,666 (GRCm39) missense probably damaging 0.99
R0506:Nyap2 UTSW 1 81,065,029 (GRCm39) missense probably damaging 0.99
R1512:Nyap2 UTSW 1 81,219,566 (GRCm39) missense probably damaging 0.98
R1914:Nyap2 UTSW 1 81,169,602 (GRCm39) missense probably damaging 1.00
R2018:Nyap2 UTSW 1 81,169,587 (GRCm39) missense probably benign 0.03
R2078:Nyap2 UTSW 1 81,169,696 (GRCm39) missense probably damaging 1.00
R2139:Nyap2 UTSW 1 81,218,983 (GRCm39) missense probably damaging 1.00
R2915:Nyap2 UTSW 1 81,065,188 (GRCm39) nonsense probably null
R2972:Nyap2 UTSW 1 81,169,485 (GRCm39) nonsense probably null
R2974:Nyap2 UTSW 1 81,169,485 (GRCm39) nonsense probably null
R3076:Nyap2 UTSW 1 81,219,686 (GRCm39) critical splice donor site probably null
R4066:Nyap2 UTSW 1 81,219,550 (GRCm39) missense probably damaging 1.00
R4134:Nyap2 UTSW 1 81,218,908 (GRCm39) missense probably damaging 0.99
R4298:Nyap2 UTSW 1 81,218,811 (GRCm39) missense probably damaging 1.00
R4652:Nyap2 UTSW 1 81,314,444 (GRCm39) missense probably damaging 0.98
R4788:Nyap2 UTSW 1 81,247,112 (GRCm39) missense probably benign
R4816:Nyap2 UTSW 1 81,219,028 (GRCm39) missense probably damaging 1.00
R5211:Nyap2 UTSW 1 81,064,991 (GRCm39) start codon destroyed probably null 0.77
R5327:Nyap2 UTSW 1 81,169,756 (GRCm39) missense possibly damaging 0.77
R5453:Nyap2 UTSW 1 81,169,857 (GRCm39) missense probably benign 0.01
R7558:Nyap2 UTSW 1 81,247,088 (GRCm39) missense probably benign 0.01
R8078:Nyap2 UTSW 1 81,218,772 (GRCm39) missense possibly damaging 0.95
R8231:Nyap2 UTSW 1 81,169,846 (GRCm39) missense probably benign
R8482:Nyap2 UTSW 1 81,219,352 (GRCm39) missense probably damaging 1.00
R9047:Nyap2 UTSW 1 81,275,803 (GRCm39) missense possibly damaging 0.95
R9056:Nyap2 UTSW 1 81,314,314 (GRCm39) missense probably benign 0.15
R9193:Nyap2 UTSW 1 81,275,712 (GRCm39) missense probably damaging 0.97
R9210:Nyap2 UTSW 1 81,219,042 (GRCm39) missense probably damaging 1.00
R9260:Nyap2 UTSW 1 81,064,835 (GRCm39) intron probably benign
X0067:Nyap2 UTSW 1 81,247,034 (GRCm39) missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- CTTATTGCGCCATGCTATTGG -3'
(R):5'- ACGGTGGAGGACTGTACTTC -3'

Sequencing Primer
(F):5'- GGAAGTATTTCCGTCCAAAGTG -3'
(R):5'- GGAGGACTGTACTTCTTTGCTCC -3'
Posted On 2019-09-13