Mutagenetix > Incidental Mutations

Incidental Mutation 'R7337:Ptprf'

569560

Institutional Source

Beutler Lab

Gene Symbol

Ptprf

Ensembl Gene

ENSMUSG00000033295

Gene Name

protein tyrosine phosphatase, receptor type, F

Synonyms

RPTP-LAR, LAR

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.785) question?

Stock #

R7337 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

118208213-118291405 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 118211125 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 1738 (E1738G)

Ref Sequence

ENSEMBL: ENSMUSP00000039368 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049074]

PDB Structure

Tandem Ig domains of tyrosine phosphatase LAR [X-RAY DIFFRACTION]

Predicted Effect

probably damaging
Transcript: ENSMUST00000049074
AA Change: E1738G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000039368
Gene: ENSMUSG00000033295
AA Change: E1738G

Domain	Start	End	E-Value	Type
IGc2	45	114	2.64e-12	SMART
IGc2	147	214	1.48e-15	SMART
IG	238	316	1.06e-11	SMART
FN3	319	398	6.9e-14	SMART
FN3	414	497	5.73e-11	SMART
FN3	512	591	4.06e-11	SMART
FN3	606	693	8.69e-11	SMART
FN3	709	797	8.83e-12	SMART
FN3	812	892	3.2e-9	SMART
FN3	907	988	2.53e-12	SMART
FN3	1003	1079	3.48e-1	SMART
coiled coil region	1146	1175	N/A	INTRINSIC
transmembrane domain	1253	1275	N/A	INTRINSIC
PTPc	1342	1600	1.12e-138	SMART
PTPc	1629	1891	3.4e-129	SMART

Predicted Effect

SMART Domains

Protein: ENSMUSP00000119954
Gene: ENSMUSG00000033295
AA Change: E1171G

Domain	Start	End	E-Value	Type
FN3	37	116	4.06e-11	SMART
FN3	132	220	8.83e-12	SMART
FN3	235	315	3.2e-9	SMART
FN3	330	411	2.53e-12	SMART
FN3	426	502	3.48e-1	SMART
coiled coil region	568	597	N/A	INTRINSIC
transmembrane domain	676	698	N/A	INTRINSIC
PTPc	776	1034	1.12e-138	SMART
PTPc	1063	1325	3.4e-129	SMART

Predicted Effect

SMART Domains

Protein: ENSMUSP00000117313
Gene: ENSMUSG00000033295
AA Change: E1130G

Domain	Start	End	E-Value	Type
FN3	14	66	2.7e1	SMART
FN3	82	165	5.73e-11	SMART
FN3	180	259	4.06e-11	SMART
FN3	275	372	6.69e-12	SMART
FN3	385	461	2.83e-1	SMART
coiled coil region	527	556	N/A	INTRINSIC
transmembrane domain	635	657	N/A	INTRINSIC
PTPc	735	993	1.12e-138	SMART
PTPc	1022	1284	3.4e-129	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (88/88)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem intracytoplasmic catalytic domains, and thus represents a receptor-type PTP. The extracellular region contains three Ig-like domains, and nine non-Ig like domains similar to that of neural-cell adhesion molecule. This PTP was shown to function in the regulation of epithelial cell-cell contacts at adherents junctions, as well as in the control of beta-catenin signaling. An increased expression level of this protein was found in the insulin-responsive tissue of obese, insulin-resistant individuals, and may contribute to the pathogenesis of insulin resistance. Two alternatively spliced transcript variants of this gene, which encode distinct proteins, have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null females have premature involution of the mammary glands leading to an inability to feed pups. Other characteristics of null mice include defective nerve regeneration and hyperactivity. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 88 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700011H14Rik	A	G	14: 49,234,491	M163T	possibly damaging	Het
Abcb11	A	T	2: 69,245,769	H1198Q	probably damaging	Het
Adamts14	A	G	10: 61,207,460	V743A	probably damaging	Het
Adgrg6	A	G	10: 14,467,351	V284A	possibly damaging	Het
AI314180	T	C	4: 58,827,047	T1029A	possibly damaging	Het
Alb	A	G	5: 90,474,593	K560R	probably damaging	Het
Aqp9	A	T	9: 71,162,482	F8L	probably benign	Het
Arhgef7	T	C	8: 11,785,789	L182P	probably damaging	Het
Atr	A	G	9: 95,871,448	D701G	probably damaging	Het
Calr3	C	T	8: 72,431,495	D187N	probably damaging	Het
Ccdc65	A	G	15: 98,721,096	T319A	probably benign	Het
Ccdc66	A	T	14: 27,500,333	L151H	probably damaging	Het
Ces2e	T	A	8: 104,931,056		probably null	Het
Cfap46	A	G	7: 139,630,576		probably null	Het
Cfap74	A	G	4: 155,460,015	T1034A	unknown	Het
Cldnd1	T	G	16: 58,728,959		probably null	Het
Clec4f	C	A	6: 83,653,208	V123L	probably benign	Het
Cntn6	C	T	6: 104,650,530	T108I	probably damaging	Het
Crygn	T	G	5: 24,756,149	D53A	possibly damaging	Het
Cyp27a1	T	A	1: 74,735,435	V204E	probably damaging	Het
Cyp2c67	A	T	19: 39,609,264		probably null	Het
Ddb1	T	C	19: 10,627,831	V1061A	possibly damaging	Het
Dnah12	G	T	14: 26,766,577		probably null	Het
Draxin	T	C	4: 148,112,759	T194A	probably benign	Het
Drosha	T	A	15: 12,846,199	D473E	possibly damaging	Het
G6pd2	T	A	5: 61,810,219	C446S	probably benign	Het
Gm29106	C	T	1: 118,176,912	S3L	unknown	Het
Grin3a	T	C	4: 49,702,762	Y908C	probably damaging	Het
Ints2	G	A	11: 86,217,842	A893V	probably benign	Het
Ippk	C	T	13: 49,449,291	T371I	probably benign	Het
Irf2	T	A	8: 46,807,281	C83S	probably damaging	Het
Jph3	C	T	8: 121,753,702	A373V	probably benign	Het
Kcnj6	C	T	16: 94,833,214	V13I	probably benign	Het
Lama3	T	C	18: 12,507,040		probably null	Het
Lmo7	A	T	14: 101,884,204	Q235L	probably damaging	Het
March7	A	G	2: 60,240,845		probably null	Het
Mfsd6l	A	T	11: 68,557,283	Y320F	possibly damaging	Het
Mroh1	T	A	15: 76,451,476	W1440R	probably benign	Het
Mrps17	G	A	5: 129,716,799	G19D	probably damaging	Het
Myt1	A	G	2: 181,802,963	H566R	possibly damaging	Het
Nav2	T	C	7: 49,551,773	L176P	possibly damaging	Het
Nop58	T	A	1: 59,698,440	C139S	probably benign	Het
Nsd1	A	G	13: 55,246,209	D644G	probably damaging	Het
Nsd2	T	A	5: 33,885,472	C1027S	probably damaging	Het
Nsmce2	A	G	15: 59,601,416	I235V	probably damaging	Het
Nyap2	T	C	1: 81,336,515	V642A	possibly damaging	Het
Olfr300-ps1	A	T	7: 86,443,120	L46F	unknown	Het
Olfr919	A	G	9: 38,697,865	V167A	probably benign	Het
Paqr7	A	G	4: 134,507,120	D96G	probably benign	Het
Parp4	A	G	14: 56,602,395	Y520C	probably damaging	Het
Pde5a	A	G	3: 122,748,458	N199S	probably damaging	Het
Piezo1	A	T	8: 122,485,724	Y1955N		Het
Pnmal1	A	G	7: 16,961,390	K390R	probably benign	Het
Prdm10	G	T	9: 31,316,241	Q47H	probably damaging	Het
Psg22	T	A	7: 18,719,574	F104I	probably benign	Het
Rad21l	A	T	2: 151,658,445	L218Q	probably damaging	Het
Rad54l2	A	G	9: 106,705,825	I798T	probably damaging	Het
Rgs5	G	T	1: 169,655,580	M1I	probably null	Het
Rhbdl2	T	C	4: 123,817,866	V132A	possibly damaging	Het
Rmi1	T	A	13: 58,409,579	Y547*	probably null	Het
Rptn	A	T	3: 93,396,905	D515V	probably benign	Het
Rsph10b	A	G	5: 143,961,215	N505D	probably benign	Het
Samhd1	T	C	2: 157,106,244	D539G	probably damaging	Het
Scube3	A	T	17: 28,168,182	I885F	probably damaging	Het
Sfmbt1	A	G	14: 30,784,739	I247V	possibly damaging	Het
Slc25a21	T	C	12: 56,858,043	I62V	probably benign	Het
Slc4a11	T	A	2: 130,685,532	N648Y	probably damaging	Het
Slc7a11	A	G	3: 50,442,999	V88A	possibly damaging	Het
Slc7a8	A	C	14: 54,726,806	F397V	possibly damaging	Het
Sox12	A	C	2: 152,397,457	L81R	probably damaging	Het
Spg11	T	C	2: 122,084,993	I1057V	probably benign	Het
St8sia3	G	A	18: 64,269,916	V265I	probably benign	Het
Stxbp5	A	G	10: 9,809,130	S509P	possibly damaging	Het
Svep1	T	C	4: 58,108,323	Y1129C	probably damaging	Het
Tenm4	G	T	7: 96,874,126	R1625L	probably benign	Het
Tlr4	T	C	4: 66,839,954	F328S	possibly damaging	Het
Tmprss15	T	C	16: 79,071,276	T215A	probably benign	Het
Tmprss9	A	T	10: 80,882,670	I62L	probably benign	Het
Trpm5	C	T	7: 143,089,019	A64T	probably benign	Het
Txk	A	C	5: 72,731,766	Y148*	probably null	Het
Uba5	C	T	9: 104,055,255	G170R	possibly damaging	Het
Uggt2	A	T	14: 119,086,175	D231E	probably benign	Het
Ulk4	A	T	9: 121,248,927	D525E	probably benign	Het
Vmn1r158	T	A	7: 22,790,224	T187S	probably benign	Het
Vmn1r52	T	A	6: 90,179,623	M303K	probably benign	Het
Vmn2r54	A	G	7: 12,622,117	F454S	probably benign	Het
Zbp1	A	T	2: 173,218,753	L8*	probably null	Het
Zmym2	A	T	14: 56,944,100	D924V	probably benign	Het

Other mutations in Ptprf

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00090:Ptprf	APN	4	118223220	splice site	probably benign
IGL01337:Ptprf	APN	4	118236291	missense	probably damaging	1.00
IGL01482:Ptprf	APN	4	118212454	missense	probably damaging	1.00
IGL01743:Ptprf	APN	4	118248898	critical splice donor site	probably null
IGL01987:Ptprf	APN	4	118277370	missense	probably benign
IGL02189:Ptprf	APN	4	118213642	splice site	probably benign
IGL03067:Ptprf	APN	4	118210713	missense	possibly damaging	0.67
PIT4677001:Ptprf	UTSW	4	118213612	missense	probably damaging	1.00
R0382:Ptprf	UTSW	4	118223394	splice site	probably benign
R0788:Ptprf	UTSW	4	118226466	missense	probably damaging	0.97
R1164:Ptprf	UTSW	4	118257492	missense	probably damaging	1.00
R1478:Ptprf	UTSW	4	118212105	nonsense	probably null
R1483:Ptprf	UTSW	4	118235964	missense	possibly damaging	0.81
R1611:Ptprf	UTSW	4	118236233	missense	probably benign	0.34
R1721:Ptprf	UTSW	4	118224899	missense	possibly damaging	0.56
R1817:Ptprf	UTSW	4	118223265	missense	probably benign	0.02
R1818:Ptprf	UTSW	4	118209871	missense	probably damaging	1.00
R1860:Ptprf	UTSW	4	118223932	missense	probably damaging	1.00
R2208:Ptprf	UTSW	4	118269172	splice site	probably benign
R2406:Ptprf	UTSW	4	118269304	missense	possibly damaging	0.62
R2912:Ptprf	UTSW	4	118248980	missense	probably damaging	0.98
R3111:Ptprf	UTSW	4	118211432	missense	probably damaging	1.00
R3498:Ptprf	UTSW	4	118224930	missense	probably damaging	0.99
R3499:Ptprf	UTSW	4	118224930	missense	probably damaging	0.99
R3615:Ptprf	UTSW	4	118237883	missense	probably benign	0.04
R3616:Ptprf	UTSW	4	118237883	missense	probably benign	0.04
R4038:Ptprf	UTSW	4	118257608	missense	probably damaging	1.00
R4243:Ptprf	UTSW	4	118226452	critical splice donor site	probably null
R4260:Ptprf	UTSW	4	118226083	missense	possibly damaging	0.64
R4693:Ptprf	UTSW	4	118211022	missense	probably benign	0.16
R4726:Ptprf	UTSW	4	118212217	missense	possibly damaging	0.86
R4746:Ptprf	UTSW	4	118225039	missense	possibly damaging	0.83
R4802:Ptprf	UTSW	4	118210329	intron	probably benign
R4857:Ptprf	UTSW	4	118217197	splice site	probably benign
R5071:Ptprf	UTSW	4	118211999	missense	probably damaging	1.00
R5221:Ptprf	UTSW	4	118225108	missense	probably benign	0.00
R5327:Ptprf	UTSW	4	118236389	missense	probably damaging	1.00
R5336:Ptprf	UTSW	4	118235634	missense	probably damaging	1.00
R5356:Ptprf	UTSW	4	118226338	missense	probably benign	0.00
R5373:Ptprf	UTSW	4	118226041	missense	possibly damaging	0.93
R5555:Ptprf	UTSW	4	118224924	missense	probably damaging	1.00
R5693:Ptprf	UTSW	4	118236177	nonsense	probably null
R5860:Ptprf	UTSW	4	118211289	intron	probably benign
R5869:Ptprf	UTSW	4	118210382	missense	probably damaging	1.00
R5890:Ptprf	UTSW	4	118224735	missense	probably benign
R5932:Ptprf	UTSW	4	118211767	missense	probably benign	0.10
R6028:Ptprf	UTSW	4	118213629	missense	probably benign	0.01
R6030:Ptprf	UTSW	4	118211048	missense	probably benign	0.19
R6030:Ptprf	UTSW	4	118211048	missense	probably benign	0.19
R6088:Ptprf	UTSW	4	118210755	missense	possibly damaging	0.68
R6089:Ptprf	UTSW	4	118211084	missense	probably damaging	0.99
R6108:Ptprf	UTSW	4	118223256	missense	probably benign	0.01
R6320:Ptprf	UTSW	4	118212814	missense	probably benign
R6741:Ptprf	UTSW	4	118223368	missense	probably benign	0.00
R6744:Ptprf	UTSW	4	118236365	missense	probably benign	0.00
R6750:Ptprf	UTSW	4	118231731	missense	probably benign	0.03
R6906:Ptprf	UTSW	4	118269277	missense	possibly damaging	0.95
R7021:Ptprf	UTSW	4	118223904	missense	probably benign	0.00
R7153:Ptprf	UTSW	4	118231543	missense	probably damaging	1.00
R7326:Ptprf	UTSW	4	118231669	missense	probably damaging	0.99
R7374:Ptprf	UTSW	4	118257492	missense	probably damaging	1.00
R7375:Ptprf	UTSW	4	118212814	missense	probably benign
R7399:Ptprf	UTSW	4	118226523	missense	probably benign	0.28
R7417:Ptprf	UTSW	4	118212172	missense	probably damaging	1.00
R7448:Ptprf	UTSW	4	118235667	missense	probably benign	0.03
R7530:Ptprf	UTSW	4	118212748	missense	probably damaging	1.00
R7593:Ptprf	UTSW	4	118212396	missense	probably benign	0.00
X0067:Ptprf	UTSW	4	118236026	missense	possibly damaging	0.85

Predicted Primers

PCR Primer
(F):5'- GGAGGTAACGCAAACAACTC -3'
(R):5'- ACCAGCTACCCTTGGGAAAG -3'

Sequencing Primer
(F):5'- GACTCAGATCCCTGCAGTGTC -3'
(R):5'- CTTTACCAACACCTGAGG -3'

Posted On

2019-09-13