Mutagenetix > Incidental Mutations

Incidental Mutation 'R7337:Cntn6'

569574

Institutional Source

Beutler Lab

Gene Symbol

Cntn6

Ensembl Gene

ENSMUSG00000030092

Gene Name

contactin 6

Synonyms

NB-3

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.216) question?

Stock #

R7337 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

104492790-104863406 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 104650530 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 108 (T108I)

Ref Sequence

ENSEMBL: ENSMUSP00000086623 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000089215] [ENSMUST00000161070] [ENSMUST00000162872]

AlphaFold

Q9JMB8

Predicted Effect

probably damaging
Transcript: ENSMUST00000089215
AA Change: T108I

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000086623
Gene: ENSMUSG00000030092
AA Change: T108I

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
IGc2	41	107	5.24e-7	SMART
IG	129	217	2.28e-7	SMART
IGc2	240	304	4e-12	SMART
IGc2	330	393	4.52e-11	SMART
IGc2	422	486	5.48e-10	SMART
IGc2	512	584	1.44e-4	SMART
FN3	598	684	2.17e-11	SMART
FN3	701	787	8.62e0	SMART
FN3	803	888	9.92e-6	SMART
FN3	903	983	8.17e0	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000161070
AA Change: T36I

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000124714
Gene: ENSMUSG00000030092
AA Change: T36I

Domain	Start	End	E-Value	Type
SCOP:d1cs6a4	4	40	5e-4	SMART
IG	57	145	2.28e-7	SMART
IGc2	168	232	4e-12	SMART
IGc2	258	321	4.52e-11	SMART
IGc2	350	414	5.48e-10	SMART
IGc2	440	512	1.44e-4	SMART
FN3	526	612	2.17e-11	SMART
FN3	629	715	8.62e0	SMART
FN3	731	816	9.92e-6	SMART
FN3	831	911	8.17e0	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000162872
AA Change: T108I

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000124025
Gene: ENSMUSG00000030092
AA Change: T108I

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
IGc2	41	107	5.24e-7	SMART
IG	129	217	2.28e-7	SMART
IGc2	240	304	4e-12	SMART
IGc2	330	393	4.52e-11	SMART
IGc2	422	486	5.48e-10	SMART
IGc2	512	584	1.44e-4	SMART
FN3	598	684	2.17e-11	SMART
FN3	701	787	8.62e0	SMART
FN3	803	888	9.92e-6	SMART
FN3	903	983	8.17e0	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (88/88)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the immunoglobulin superfamily. It is a glycosylphosphatidylinositol (GPI)-anchored neuronal membrane protein that functions as a cell adhesion molecule. It may play a role in the formation of axon connections in the developing nervous system. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for disruption of this gene display impaired coordination without any obvious morphological of physiological abnormalities in the brain. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 88 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700011H14Rik	A	G	14: 49,234,491	M163T	possibly damaging	Het
Abcb11	A	T	2: 69,245,769	H1198Q	probably damaging	Het
Adamts14	A	G	10: 61,207,460	V743A	probably damaging	Het
Adgrg6	A	G	10: 14,467,351	V284A	possibly damaging	Het
AI314180	T	C	4: 58,827,047	T1029A	possibly damaging	Het
Alb	A	G	5: 90,474,593	K560R	probably damaging	Het
Aqp9	A	T	9: 71,162,482	F8L	probably benign	Het
Arhgef7	T	C	8: 11,785,789	L182P	probably damaging	Het
Atr	A	G	9: 95,871,448	D701G	probably damaging	Het
Calr3	C	T	8: 72,431,495	D187N	probably damaging	Het
Ccdc65	A	G	15: 98,721,096	T319A	probably benign	Het
Ccdc66	A	T	14: 27,500,333	L151H	probably damaging	Het
Ces2e	T	A	8: 104,931,056		probably null	Het
Cfap46	A	G	7: 139,630,576		probably null	Het
Cfap74	A	G	4: 155,460,015	T1034A	unknown	Het
Cldnd1	T	G	16: 58,728,959		probably null	Het
Clec4f	C	A	6: 83,653,208	V123L	probably benign	Het
Crygn	T	G	5: 24,756,149	D53A	possibly damaging	Het
Cyp27a1	T	A	1: 74,735,435	V204E	probably damaging	Het
Cyp2c67	A	T	19: 39,609,264		probably null	Het
Ddb1	T	C	19: 10,627,831	V1061A	possibly damaging	Het
Dnah12	G	T	14: 26,766,577		probably null	Het
Draxin	T	C	4: 148,112,759	T194A	probably benign	Het
Drosha	T	A	15: 12,846,199	D473E	possibly damaging	Het
G6pd2	T	A	5: 61,810,219	C446S	probably benign	Het
Gm29106	C	T	1: 118,176,912	S3L	unknown	Het
Grin3a	T	C	4: 49,702,762	Y908C	probably damaging	Het
Ints2	G	A	11: 86,217,842	A893V	probably benign	Het
Ippk	C	T	13: 49,449,291	T371I	probably benign	Het
Irf2	T	A	8: 46,807,281	C83S	probably damaging	Het
Jph3	C	T	8: 121,753,702	A373V	probably benign	Het
Kcnj6	C	T	16: 94,833,214	V13I	probably benign	Het
Lama3	T	C	18: 12,507,040		probably null	Het
Lmo7	A	T	14: 101,884,204	Q235L	probably damaging	Het
March7	A	G	2: 60,240,845		probably null	Het
Mfsd6l	A	T	11: 68,557,283	Y320F	possibly damaging	Het
Mroh1	T	A	15: 76,451,476	W1440R	probably benign	Het
Mrps17	G	A	5: 129,716,799	G19D	probably damaging	Het
Myt1	A	G	2: 181,802,963	H566R	possibly damaging	Het
Nav2	T	C	7: 49,551,773	L176P	possibly damaging	Het
Nop58	T	A	1: 59,698,440	C139S	probably benign	Het
Nsd1	A	G	13: 55,246,209	D644G	probably damaging	Het
Nsd2	T	A	5: 33,885,472	C1027S	probably damaging	Het
Nsmce2	A	G	15: 59,601,416	I235V	probably damaging	Het
Nyap2	T	C	1: 81,336,515	V642A	possibly damaging	Het
Olfr300-ps1	A	T	7: 86,443,120	L46F	unknown	Het
Olfr919	A	G	9: 38,697,865	V167A	probably benign	Het
Paqr7	A	G	4: 134,507,120	D96G	probably benign	Het
Parp4	A	G	14: 56,602,395	Y520C	probably damaging	Het
Pde5a	A	G	3: 122,748,458	N199S	probably damaging	Het
Piezo1	A	T	8: 122,485,724	Y1955N		Het
Pnmal1	A	G	7: 16,961,390	K390R	probably benign	Het
Prdm10	G	T	9: 31,316,241	Q47H	probably damaging	Het
Psg22	T	A	7: 18,719,574	F104I	probably benign	Het
Ptprf	T	C	4: 118,211,125	E1738G	probably damaging	Het
Rad21l	A	T	2: 151,658,445	L218Q	probably damaging	Het
Rad54l2	A	G	9: 106,705,825	I798T	probably damaging	Het
Rgs5	G	T	1: 169,655,580	M1I	probably null	Het
Rhbdl2	T	C	4: 123,817,866	V132A	possibly damaging	Het
Rmi1	T	A	13: 58,409,579	Y547*	probably null	Het
Rptn	A	T	3: 93,396,905	D515V	probably benign	Het
Rsph10b	A	G	5: 143,961,215	N505D	probably benign	Het
Samhd1	T	C	2: 157,106,244	D539G	probably damaging	Het
Scube3	A	T	17: 28,168,182	I885F	probably damaging	Het
Sfmbt1	A	G	14: 30,784,739	I247V	possibly damaging	Het
Slc25a21	T	C	12: 56,858,043	I62V	probably benign	Het
Slc4a11	T	A	2: 130,685,532	N648Y	probably damaging	Het
Slc7a11	A	G	3: 50,442,999	V88A	possibly damaging	Het
Slc7a8	A	C	14: 54,726,806	F397V	possibly damaging	Het
Sox12	A	C	2: 152,397,457	L81R	probably damaging	Het
Spg11	T	C	2: 122,084,993	I1057V	probably benign	Het
St8sia3	G	A	18: 64,269,916	V265I	probably benign	Het
Stxbp5	A	G	10: 9,809,130	S509P	possibly damaging	Het
Svep1	T	C	4: 58,108,323	Y1129C	probably damaging	Het
Tenm4	G	T	7: 96,874,126	R1625L	probably benign	Het
Tlr4	T	C	4: 66,839,954	F328S	possibly damaging	Het
Tmprss15	T	C	16: 79,071,276	T215A	probably benign	Het
Tmprss9	A	T	10: 80,882,670	I62L	probably benign	Het
Trpm5	C	T	7: 143,089,019	A64T	probably benign	Het
Txk	A	C	5: 72,731,766	Y148*	probably null	Het
Uba5	C	T	9: 104,055,255	G170R	possibly damaging	Het
Uggt2	A	T	14: 119,086,175	D231E	probably benign	Het
Ulk4	A	T	9: 121,248,927	D525E	probably benign	Het
Vmn1r158	T	A	7: 22,790,224	T187S	probably benign	Het
Vmn1r52	T	A	6: 90,179,623	M303K	probably benign	Het
Vmn2r54	A	G	7: 12,622,117	F454S	probably benign	Het
Zbp1	A	T	2: 173,218,753	L8*	probably null	Het
Zmym2	A	T	14: 56,944,100	D924V	probably benign	Het

Other mutations in Cntn6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00547:Cntn6	APN	6	104650400	missense	probably damaging	0.99
IGL01331:Cntn6	APN	6	104774523	missense	probably damaging	1.00
IGL01619:Cntn6	APN	6	104728374	splice site	probably benign
IGL02028:Cntn6	APN	6	104859426	missense	probably damaging	0.99
IGL02420:Cntn6	APN	6	104846142	critical splice donor site	probably null
IGL02557:Cntn6	APN	6	104774535	missense	probably damaging	1.00
IGL03000:Cntn6	APN	6	104804386	missense	probably damaging	1.00
IGL03367:Cntn6	APN	6	104804338	missense	probably damaging	1.00
IGL03383:Cntn6	APN	6	104776457	splice site	probably benign
PIT4366001:Cntn6	UTSW	6	104832537	missense	probably benign	0.05
R0490:Cntn6	UTSW	6	104833918	missense	possibly damaging	0.91
R0583:Cntn6	UTSW	6	104776314	missense	possibly damaging	0.79
R0636:Cntn6	UTSW	6	104863148	missense	probably benign	0.00
R0654:Cntn6	UTSW	6	104776428	missense	probably benign	0.00
R0960:Cntn6	UTSW	6	104774480	missense	probably benign	0.01
R1241:Cntn6	UTSW	6	104832509	missense	probably damaging	1.00
R1385:Cntn6	UTSW	6	104861900	missense	probably benign	0.07
R1401:Cntn6	UTSW	6	104804398	missense	possibly damaging	0.65
R1478:Cntn6	UTSW	6	104776428	missense	probably benign	0.00
R1542:Cntn6	UTSW	6	104848100	missense	probably damaging	1.00
R1593:Cntn6	UTSW	6	104832580	missense	possibly damaging	0.58
R1840:Cntn6	UTSW	6	104774480	missense	probably damaging	1.00
R2066:Cntn6	UTSW	6	104861822	nonsense	probably null
R2097:Cntn6	UTSW	6	104861949	missense	probably damaging	0.99
R2289:Cntn6	UTSW	6	104569028	start gained	probably benign
R2429:Cntn6	UTSW	6	104650565	missense	possibly damaging	0.96
R2967:Cntn6	UTSW	6	104726237	missense	probably benign	0.04
R4009:Cntn6	UTSW	6	104833822	missense	probably damaging	0.98
R4476:Cntn6	UTSW	6	104772561	missense	probably damaging	1.00
R4664:Cntn6	UTSW	6	104728284	missense	probably benign	0.20
R4666:Cntn6	UTSW	6	104728284	missense	probably benign	0.20
R4701:Cntn6	UTSW	6	104804360	missense	probably benign	0.01
R4780:Cntn6	UTSW	6	104845784	missense	probably damaging	1.00
R4854:Cntn6	UTSW	6	104859475	missense	possibly damaging	0.95
R4965:Cntn6	UTSW	6	104774474	missense	probably damaging	0.99
R5051:Cntn6	UTSW	6	104772597	missense	probably damaging	1.00
R5075:Cntn6	UTSW	6	104833030	missense	probably damaging	1.00
R5152:Cntn6	UTSW	6	104569113	intron	probably benign
R5291:Cntn6	UTSW	6	104726135	missense	probably damaging	1.00
R5388:Cntn6	UTSW	6	104832562	missense	probably damaging	1.00
R5852:Cntn6	UTSW	6	104835745	missense	probably damaging	0.97
R5937:Cntn6	UTSW	6	104833103	missense	possibly damaging	0.68
R5980:Cntn6	UTSW	6	104848132	missense	probably damaging	0.98
R6290:Cntn6	UTSW	6	104767890	missense	probably damaging	1.00
R6338:Cntn6	UTSW	6	104726139	missense	probably damaging	1.00
R6396:Cntn6	UTSW	6	104650500	missense	probably damaging	1.00
R6447:Cntn6	UTSW	6	104859448	missense	probably damaging	1.00
R6860:Cntn6	UTSW	6	104861946	missense	possibly damaging	0.95
R6871:Cntn6	UTSW	6	104845758	frame shift	probably null
R7012:Cntn6	UTSW	6	104726262	missense	probably damaging	0.98
R7012:Cntn6	UTSW	6	104774480	missense	probably benign	0.01
R7658:Cntn6	UTSW	6	104650483	missense	probably benign	0.29
R8133:Cntn6	UTSW	6	104728337	missense	probably benign	0.19
R8463:Cntn6	UTSW	6	104772619	missense	possibly damaging	0.64
R8909:Cntn6	UTSW	6	104848132	missense	probably benign	0.05
R9232:Cntn6	UTSW	6	104838820	missense	probably damaging	1.00
R9287:Cntn6	UTSW	6	104832510	missense	possibly damaging	0.89
R9454:Cntn6	UTSW	6	104804347	missense	possibly damaging	0.82
X0020:Cntn6	UTSW	6	104767884	missense	probably benign	0.00
Z1177:Cntn6	UTSW	6	104832584	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGATCATCCCACAGGTAATCATG -3'
(R):5'- GAGATTGTTCCAAGATTCCTTCAC -3'

Sequencing Primer
(F):5'- GACTTCGGCATGACTTATC -3'
(R):5'- GATTTCTATTATCCTCAGGAACACAG -3'

Posted On

2019-09-13