Incidental Mutation 'R7337:Nav2'
ID 569579
Institutional Source Beutler Lab
Gene Symbol Nav2
Ensembl Gene ENSMUSG00000052512
Gene Name neuron navigator 2
Synonyms Rainb1, Unc53H2, 5330421F07Rik, POMFIL2, HELAD1, RAINB2
MMRRC Submission 045427-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.571) question?
Stock # R7337 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 48608796-49259838 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 49201521 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 176 (L176P)
Ref Sequence ENSEMBL: ENSMUSP00000138846 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064395] [ENSMUST00000183659] [ENSMUST00000184109] [ENSMUST00000184945]
AlphaFold E9Q842
Predicted Effect possibly damaging
Transcript: ENSMUST00000064395
AA Change: L1365P

PolyPhen 2 Score 0.778 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000067448
Gene: ENSMUSG00000052512
AA Change: L1365P

DomainStartEndE-ValueType
CH 84 187 1.58e-13 SMART
low complexity region 202 210 N/A INTRINSIC
low complexity region 297 310 N/A INTRINSIC
low complexity region 337 348 N/A INTRINSIC
low complexity region 412 424 N/A INTRINSIC
coiled coil region 486 516 N/A INTRINSIC
low complexity region 580 591 N/A INTRINSIC
low complexity region 613 625 N/A INTRINSIC
low complexity region 640 662 N/A INTRINSIC
low complexity region 846 857 N/A INTRINSIC
low complexity region 920 944 N/A INTRINSIC
low complexity region 947 967 N/A INTRINSIC
low complexity region 990 1004 N/A INTRINSIC
low complexity region 1062 1074 N/A INTRINSIC
low complexity region 1343 1360 N/A INTRINSIC
low complexity region 1368 1385 N/A INTRINSIC
low complexity region 1417 1432 N/A INTRINSIC
low complexity region 1454 1466 N/A INTRINSIC
low complexity region 1526 1540 N/A INTRINSIC
low complexity region 1614 1628 N/A INTRINSIC
coiled coil region 1630 1717 N/A INTRINSIC
low complexity region 1789 1800 N/A INTRINSIC
coiled coil region 1841 1909 N/A INTRINSIC
AAA 2093 2247 1.69e-5 SMART
low complexity region 2404 2430 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183659
AA Change: L1304P

PolyPhen 2 Score 0.423 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000139309
Gene: ENSMUSG00000052512
AA Change: L1304P

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
CH 23 126 6.19e-16 SMART
low complexity region 141 149 N/A INTRINSIC
low complexity region 236 249 N/A INTRINSIC
low complexity region 276 287 N/A INTRINSIC
low complexity region 351 363 N/A INTRINSIC
coiled coil region 425 455 N/A INTRINSIC
low complexity region 519 530 N/A INTRINSIC
low complexity region 552 564 N/A INTRINSIC
low complexity region 579 601 N/A INTRINSIC
low complexity region 785 796 N/A INTRINSIC
low complexity region 859 883 N/A INTRINSIC
low complexity region 886 906 N/A INTRINSIC
low complexity region 929 943 N/A INTRINSIC
low complexity region 1001 1013 N/A INTRINSIC
low complexity region 1282 1299 N/A INTRINSIC
low complexity region 1307 1324 N/A INTRINSIC
low complexity region 1356 1371 N/A INTRINSIC
low complexity region 1393 1405 N/A INTRINSIC
low complexity region 1465 1479 N/A INTRINSIC
low complexity region 1553 1567 N/A INTRINSIC
coiled coil region 1569 1656 N/A INTRINSIC
low complexity region 1728 1739 N/A INTRINSIC
coiled coil region 1780 1848 N/A INTRINSIC
AAA 2032 2186 1.69e-5 SMART
low complexity region 2343 2369 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000184109
AA Change: L176P

PolyPhen 2 Score 0.558 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000138846
Gene: ENSMUSG00000052512
AA Change: L176P

DomainStartEndE-ValueType
low complexity region 154 171 N/A INTRINSIC
low complexity region 179 196 N/A INTRINSIC
low complexity region 228 243 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184945
AA Change: L1365P

PolyPhen 2 Score 0.423 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000139045
Gene: ENSMUSG00000052512
AA Change: L1365P

DomainStartEndE-ValueType
CH 84 187 1.58e-13 SMART
low complexity region 202 210 N/A INTRINSIC
low complexity region 297 310 N/A INTRINSIC
low complexity region 337 348 N/A INTRINSIC
low complexity region 412 424 N/A INTRINSIC
coiled coil region 486 516 N/A INTRINSIC
low complexity region 580 591 N/A INTRINSIC
low complexity region 613 625 N/A INTRINSIC
low complexity region 640 662 N/A INTRINSIC
low complexity region 846 857 N/A INTRINSIC
low complexity region 920 944 N/A INTRINSIC
low complexity region 947 967 N/A INTRINSIC
low complexity region 990 1004 N/A INTRINSIC
low complexity region 1062 1074 N/A INTRINSIC
low complexity region 1343 1360 N/A INTRINSIC
low complexity region 1368 1385 N/A INTRINSIC
low complexity region 1417 1432 N/A INTRINSIC
low complexity region 1454 1466 N/A INTRINSIC
low complexity region 1526 1540 N/A INTRINSIC
low complexity region 1614 1628 N/A INTRINSIC
coiled coil region 1630 1717 N/A INTRINSIC
low complexity region 1789 1800 N/A INTRINSIC
coiled coil region 1841 1909 N/A INTRINSIC
AAA 2093 2247 1.69e-5 SMART
low complexity region 2404 2430 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (88/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neuron navigator gene family, which may play a role in cellular growth and migration. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous null mice display impaired olfaction and hearing, increased latency in a hot plate test, degeneration of the optic nerve, decreased exploration in new environments, and weight loss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 A T 2: 69,076,113 (GRCm39) H1198Q probably damaging Het
Adamts14 A G 10: 61,043,239 (GRCm39) V743A probably damaging Het
Adgrg6 A G 10: 14,343,095 (GRCm39) V284A possibly damaging Het
Alb A G 5: 90,622,452 (GRCm39) K560R probably damaging Het
Aqp9 A T 9: 71,069,764 (GRCm39) F8L probably benign Het
Arhgef7 T C 8: 11,835,789 (GRCm39) L182P probably damaging Het
Atr A G 9: 95,753,501 (GRCm39) D701G probably damaging Het
Calr3 C T 8: 73,185,339 (GRCm39) D187N probably damaging Het
Ccdc198 A G 14: 49,471,948 (GRCm39) M163T possibly damaging Het
Ccdc65 A G 15: 98,618,977 (GRCm39) T319A probably benign Het
Ccdc66 A T 14: 27,222,290 (GRCm39) L151H probably damaging Het
Ces2e T A 8: 105,657,688 (GRCm39) probably null Het
Cfap46 A G 7: 139,210,492 (GRCm39) probably null Het
Cfap74 A G 4: 155,544,472 (GRCm39) T1034A unknown Het
Cldnd1 T G 16: 58,549,322 (GRCm39) probably null Het
Clec4f C A 6: 83,630,190 (GRCm39) V123L probably benign Het
Cntn6 C T 6: 104,627,491 (GRCm39) T108I probably damaging Het
Crygn T G 5: 24,961,147 (GRCm39) D53A possibly damaging Het
Cyp27a1 T A 1: 74,774,594 (GRCm39) V204E probably damaging Het
Cyp2c67 A T 19: 39,597,708 (GRCm39) probably null Het
Ddb1 T C 19: 10,605,195 (GRCm39) V1061A possibly damaging Het
Dnah12 G T 14: 26,488,534 (GRCm39) probably null Het
Draxin T C 4: 148,197,216 (GRCm39) T194A probably benign Het
Drosha T A 15: 12,846,285 (GRCm39) D473E possibly damaging Het
Ecpas T C 4: 58,827,047 (GRCm39) T1029A possibly damaging Het
G6pd2 T A 5: 61,967,562 (GRCm39) C446S probably benign Het
Gm29106 C T 1: 118,104,642 (GRCm39) S3L unknown Het
Grin3a T C 4: 49,702,762 (GRCm39) Y908C probably damaging Het
Ints2 G A 11: 86,108,668 (GRCm39) A893V probably benign Het
Ippk C T 13: 49,602,767 (GRCm39) T371I probably benign Het
Irf2 T A 8: 47,260,316 (GRCm39) C83S probably damaging Het
Jph3 C T 8: 122,480,441 (GRCm39) A373V probably benign Het
Kcnj6 C T 16: 94,634,073 (GRCm39) V13I probably benign Het
Lama3 T C 18: 12,640,097 (GRCm39) probably null Het
Lmo7 A T 14: 102,121,640 (GRCm39) Q235L probably damaging Het
Marchf7 A G 2: 60,071,189 (GRCm39) probably null Het
Mfsd6l A T 11: 68,448,109 (GRCm39) Y320F possibly damaging Het
Mroh1 T A 15: 76,335,676 (GRCm39) W1440R probably benign Het
Mrps17 G A 5: 129,793,863 (GRCm39) G19D probably damaging Het
Myt1 A G 2: 181,444,756 (GRCm39) H566R possibly damaging Het
Nop58 T A 1: 59,737,599 (GRCm39) C139S probably benign Het
Nsd1 A G 13: 55,394,022 (GRCm39) D644G probably damaging Het
Nsd2 T A 5: 34,042,816 (GRCm39) C1027S probably damaging Het
Nsmce2 A G 15: 59,473,265 (GRCm39) I235V probably damaging Het
Nyap2 T C 1: 81,314,230 (GRCm39) V642A possibly damaging Het
Or14n1-ps1 A T 7: 86,092,328 (GRCm39) L46F unknown Het
Or8g51 A G 9: 38,609,161 (GRCm39) V167A probably benign Het
Paqr7 A G 4: 134,234,431 (GRCm39) D96G probably benign Het
Parp4 A G 14: 56,839,852 (GRCm39) Y520C probably damaging Het
Pde5a A G 3: 122,542,107 (GRCm39) N199S probably damaging Het
Piezo1 A T 8: 123,212,463 (GRCm39) Y1955N Het
Pnma8a A G 7: 16,695,315 (GRCm39) K390R probably benign Het
Prdm10 G T 9: 31,227,537 (GRCm39) Q47H probably damaging Het
Psg22 T A 7: 18,453,499 (GRCm39) F104I probably benign Het
Ptprf T C 4: 118,068,322 (GRCm39) E1738G probably damaging Het
Rad21l A T 2: 151,500,365 (GRCm39) L218Q probably damaging Het
Rad54l2 A G 9: 106,583,024 (GRCm39) I798T probably damaging Het
Rgs5 G T 1: 169,483,149 (GRCm39) M1I probably null Het
Rhbdl2 T C 4: 123,711,659 (GRCm39) V132A possibly damaging Het
Rmi1 T A 13: 58,557,393 (GRCm39) Y547* probably null Het
Rptn A T 3: 93,304,212 (GRCm39) D515V probably benign Het
Rsph10b A G 5: 143,898,033 (GRCm39) N505D probably benign Het
Samhd1 T C 2: 156,948,164 (GRCm39) D539G probably damaging Het
Scube3 A T 17: 28,387,156 (GRCm39) I885F probably damaging Het
Sfmbt1 A G 14: 30,506,696 (GRCm39) I247V possibly damaging Het
Slc25a21 T C 12: 56,904,828 (GRCm39) I62V probably benign Het
Slc4a11 T A 2: 130,527,452 (GRCm39) N648Y probably damaging Het
Slc7a11 A G 3: 50,397,448 (GRCm39) V88A possibly damaging Het
Slc7a8 A C 14: 54,964,263 (GRCm39) F397V possibly damaging Het
Sox12 A C 2: 152,239,377 (GRCm39) L81R probably damaging Het
Spg11 T C 2: 121,915,474 (GRCm39) I1057V probably benign Het
St8sia3 G A 18: 64,402,987 (GRCm39) V265I probably benign Het
Stxbp5 A G 10: 9,684,874 (GRCm39) S509P possibly damaging Het
Svep1 T C 4: 58,108,323 (GRCm39) Y1129C probably damaging Het
Tenm4 G T 7: 96,523,333 (GRCm39) R1625L probably benign Het
Tlr4 T C 4: 66,758,191 (GRCm39) F328S possibly damaging Het
Tmprss15 T C 16: 78,868,164 (GRCm39) T215A probably benign Het
Tmprss9 A T 10: 80,718,504 (GRCm39) I62L probably benign Het
Trpm5 C T 7: 142,642,756 (GRCm39) A64T probably benign Het
Txk A C 5: 72,889,109 (GRCm39) Y148* probably null Het
Uba5 C T 9: 103,932,454 (GRCm39) G170R possibly damaging Het
Uggt2 A T 14: 119,323,587 (GRCm39) D231E probably benign Het
Ulk4 A T 9: 121,077,993 (GRCm39) D525E probably benign Het
Vmn1r158 T A 7: 22,489,649 (GRCm39) T187S probably benign Het
Vmn1r52 T A 6: 90,156,605 (GRCm39) M303K probably benign Het
Vmn2r54 A G 7: 12,356,044 (GRCm39) F454S probably benign Het
Zbp1 A T 2: 173,060,546 (GRCm39) L8* probably null Het
Zmym2 A T 14: 57,181,557 (GRCm39) D924V probably benign Het
Other mutations in Nav2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01097:Nav2 APN 7 49,220,942 (GRCm39) missense probably damaging 1.00
IGL01150:Nav2 APN 7 49,102,269 (GRCm39) missense probably benign 0.17
IGL01649:Nav2 APN 7 49,225,477 (GRCm39) missense probably damaging 1.00
IGL01662:Nav2 APN 7 49,220,957 (GRCm39) missense probably damaging 1.00
IGL02297:Nav2 APN 7 49,243,977 (GRCm39) missense probably damaging 0.98
IGL02313:Nav2 APN 7 49,208,521 (GRCm39) missense probably damaging 0.99
IGL02441:Nav2 APN 7 49,102,260 (GRCm39) missense probably damaging 1.00
IGL02472:Nav2 APN 7 49,195,789 (GRCm39) missense probably damaging 1.00
IGL02477:Nav2 APN 7 49,232,623 (GRCm39) missense probably damaging 0.99
IGL02725:Nav2 APN 7 49,214,843 (GRCm39) missense probably damaging 1.00
IGL02944:Nav2 APN 7 49,070,004 (GRCm39) missense probably damaging 0.99
IGL02953:Nav2 APN 7 49,198,171 (GRCm39) missense probably damaging 1.00
IGL03105:Nav2 APN 7 49,114,627 (GRCm39) missense probably damaging 1.00
IGL03234:Nav2 APN 7 49,111,756 (GRCm39) missense possibly damaging 0.94
IGL03274:Nav2 APN 7 49,011,847 (GRCm39) missense probably damaging 1.00
IGL03294:Nav2 APN 7 49,141,205 (GRCm39) nonsense probably null
R0006:Nav2 UTSW 7 49,102,978 (GRCm39) missense possibly damaging 0.50
R0070:Nav2 UTSW 7 49,220,462 (GRCm39) missense probably damaging 1.00
R0113:Nav2 UTSW 7 49,185,701 (GRCm39) missense probably damaging 1.00
R0306:Nav2 UTSW 7 49,195,651 (GRCm39) missense probably benign 0.01
R0346:Nav2 UTSW 7 49,254,333 (GRCm39) missense probably benign 0.11
R0539:Nav2 UTSW 7 49,111,686 (GRCm39) missense probably damaging 1.00
R0669:Nav2 UTSW 7 49,058,431 (GRCm39) missense probably damaging 1.00
R0785:Nav2 UTSW 7 49,070,081 (GRCm39) missense probably benign 0.06
R0970:Nav2 UTSW 7 49,233,901 (GRCm39) missense probably damaging 1.00
R1162:Nav2 UTSW 7 49,185,788 (GRCm39) splice site probably benign
R1274:Nav2 UTSW 7 49,254,178 (GRCm39) nonsense probably null
R1463:Nav2 UTSW 7 49,185,710 (GRCm39) missense probably damaging 1.00
R1464:Nav2 UTSW 7 49,011,952 (GRCm39) missense probably damaging 1.00
R1464:Nav2 UTSW 7 49,011,952 (GRCm39) missense probably damaging 1.00
R1536:Nav2 UTSW 7 49,195,682 (GRCm39) missense probably damaging 1.00
R1612:Nav2 UTSW 7 49,220,959 (GRCm39) missense probably damaging 1.00
R1638:Nav2 UTSW 7 49,102,213 (GRCm39) missense probably benign
R1731:Nav2 UTSW 7 49,197,922 (GRCm39) missense probably damaging 1.00
R1734:Nav2 UTSW 7 49,225,468 (GRCm39) missense probably damaging 1.00
R1865:Nav2 UTSW 7 49,197,943 (GRCm39) missense possibly damaging 0.95
R1945:Nav2 UTSW 7 49,114,620 (GRCm39) missense probably damaging 1.00
R1997:Nav2 UTSW 7 49,198,219 (GRCm39) missense probably benign 0.16
R2061:Nav2 UTSW 7 49,248,645 (GRCm39) splice site probably benign
R2117:Nav2 UTSW 7 49,114,328 (GRCm39) missense probably benign 0.00
R2174:Nav2 UTSW 7 49,102,411 (GRCm39) missense probably damaging 0.99
R2182:Nav2 UTSW 7 49,247,002 (GRCm39) missense probably benign 0.38
R2251:Nav2 UTSW 7 49,103,025 (GRCm39) missense probably damaging 1.00
R2283:Nav2 UTSW 7 49,141,152 (GRCm39) missense probably damaging 1.00
R2343:Nav2 UTSW 7 49,248,565 (GRCm39) missense possibly damaging 0.82
R2472:Nav2 UTSW 7 49,058,632 (GRCm39) missense probably benign
R2568:Nav2 UTSW 7 49,247,312 (GRCm39) missense probably damaging 1.00
R2656:Nav2 UTSW 7 49,195,690 (GRCm39) missense probably damaging 1.00
R2964:Nav2 UTSW 7 49,206,780 (GRCm39) missense probably damaging 1.00
R2966:Nav2 UTSW 7 49,206,780 (GRCm39) missense probably damaging 1.00
R3817:Nav2 UTSW 7 49,114,310 (GRCm39) missense probably benign 0.00
R3834:Nav2 UTSW 7 49,195,606 (GRCm39) missense possibly damaging 0.91
R4207:Nav2 UTSW 7 49,246,979 (GRCm39) missense probably damaging 1.00
R4207:Nav2 UTSW 7 49,222,046 (GRCm39) splice site probably null
R4411:Nav2 UTSW 7 49,047,857 (GRCm39) missense probably benign 0.37
R4413:Nav2 UTSW 7 49,047,857 (GRCm39) missense probably benign 0.37
R4440:Nav2 UTSW 7 49,225,011 (GRCm39) splice site probably benign
R4440:Nav2 UTSW 7 49,201,785 (GRCm39) missense possibly damaging 0.86
R4454:Nav2 UTSW 7 49,198,292 (GRCm39) splice site probably null
R4729:Nav2 UTSW 7 49,102,567 (GRCm39) missense probably benign 0.17
R4801:Nav2 UTSW 7 49,195,600 (GRCm39) missense possibly damaging 0.94
R4802:Nav2 UTSW 7 49,195,600 (GRCm39) missense possibly damaging 0.94
R4824:Nav2 UTSW 7 49,058,749 (GRCm39) intron probably benign
R4887:Nav2 UTSW 7 49,198,182 (GRCm39) nonsense probably null
R4908:Nav2 UTSW 7 49,254,258 (GRCm39) missense probably damaging 1.00
R4952:Nav2 UTSW 7 48,954,288 (GRCm39) intron probably benign
R4965:Nav2 UTSW 7 49,202,625 (GRCm39) nonsense probably null
R5169:Nav2 UTSW 7 49,198,231 (GRCm39) nonsense probably null
R5224:Nav2 UTSW 7 49,201,473 (GRCm39) missense probably benign 0.00
R5249:Nav2 UTSW 7 49,185,661 (GRCm39) missense probably damaging 1.00
R5285:Nav2 UTSW 7 49,197,982 (GRCm39) missense probably damaging 1.00
R5314:Nav2 UTSW 7 49,058,440 (GRCm39) small deletion probably benign
R5320:Nav2 UTSW 7 49,141,121 (GRCm39) missense probably benign 0.00
R5377:Nav2 UTSW 7 49,238,908 (GRCm39) missense probably benign 0.02
R5471:Nav2 UTSW 7 49,197,917 (GRCm39) missense probably damaging 1.00
R5754:Nav2 UTSW 7 49,206,794 (GRCm39) missense probably damaging 1.00
R5832:Nav2 UTSW 7 49,197,817 (GRCm39) splice site probably null
R5884:Nav2 UTSW 7 49,246,917 (GRCm39) nonsense probably null
R5921:Nav2 UTSW 7 48,954,324 (GRCm39) intron probably benign
R6180:Nav2 UTSW 7 49,107,915 (GRCm39) missense probably benign 0.39
R6208:Nav2 UTSW 7 49,213,851 (GRCm39) missense probably damaging 0.99
R6373:Nav2 UTSW 7 49,102,923 (GRCm39) missense probably damaging 1.00
R6450:Nav2 UTSW 7 49,244,114 (GRCm39) missense probably damaging 1.00
R6522:Nav2 UTSW 7 49,247,281 (GRCm39) missense probably damaging 1.00
R6626:Nav2 UTSW 7 49,244,100 (GRCm39) missense probably damaging 1.00
R6695:Nav2 UTSW 7 49,114,652 (GRCm39) missense probably benign 0.04
R6705:Nav2 UTSW 7 49,201,664 (GRCm39) missense probably damaging 1.00
R6842:Nav2 UTSW 7 49,107,917 (GRCm39) missense possibly damaging 0.91
R6847:Nav2 UTSW 7 49,141,204 (GRCm39) missense probably benign 0.14
R7287:Nav2 UTSW 7 49,070,076 (GRCm39) missense probably benign 0.01
R7312:Nav2 UTSW 7 49,111,672 (GRCm39) missense possibly damaging 0.55
R7315:Nav2 UTSW 7 49,198,037 (GRCm39) missense possibly damaging 0.61
R7366:Nav2 UTSW 7 49,203,951 (GRCm39) splice site probably null
R7451:Nav2 UTSW 7 49,202,577 (GRCm39) splice site probably null
R7545:Nav2 UTSW 7 49,232,605 (GRCm39) missense probably damaging 1.00
R7706:Nav2 UTSW 7 49,244,067 (GRCm39) missense probably benign 0.35
R7730:Nav2 UTSW 7 49,222,145 (GRCm39) missense probably damaging 1.00
R7812:Nav2 UTSW 7 49,246,921 (GRCm39) missense probably benign 0.13
R8097:Nav2 UTSW 7 49,237,525 (GRCm39) missense probably damaging 1.00
R8110:Nav2 UTSW 7 49,201,698 (GRCm39) nonsense probably null
R8119:Nav2 UTSW 7 49,103,232 (GRCm39) missense probably damaging 0.99
R8298:Nav2 UTSW 7 49,204,009 (GRCm39) critical splice donor site probably null
R8306:Nav2 UTSW 7 49,195,765 (GRCm39) missense probably benign 0.33
R8331:Nav2 UTSW 7 49,102,371 (GRCm39) missense probably benign
R8402:Nav2 UTSW 7 49,103,185 (GRCm39) missense probably benign 0.43
R8421:Nav2 UTSW 7 49,102,269 (GRCm39) missense probably benign
R8478:Nav2 UTSW 7 49,111,733 (GRCm39) missense probably damaging 0.99
R8724:Nav2 UTSW 7 49,141,184 (GRCm39) missense possibly damaging 0.82
R8753:Nav2 UTSW 7 49,102,320 (GRCm39) missense probably benign
R8835:Nav2 UTSW 7 49,248,551 (GRCm39) missense possibly damaging 0.83
R8933:Nav2 UTSW 7 49,111,705 (GRCm39) missense probably damaging 1.00
R8957:Nav2 UTSW 7 49,220,964 (GRCm39) missense probably damaging 1.00
R9069:Nav2 UTSW 7 49,208,561 (GRCm39) missense probably damaging 0.99
R9095:Nav2 UTSW 7 49,254,293 (GRCm39) missense probably damaging 1.00
R9223:Nav2 UTSW 7 49,202,599 (GRCm39) missense probably damaging 1.00
R9261:Nav2 UTSW 7 49,246,904 (GRCm39) missense probably damaging 1.00
X0023:Nav2 UTSW 7 49,197,647 (GRCm39) missense possibly damaging 0.47
Z1177:Nav2 UTSW 7 49,243,971 (GRCm39) missense probably benign 0.01
Z1177:Nav2 UTSW 7 49,102,509 (GRCm39) missense possibly damaging 0.47
Predicted Primers PCR Primer
(F):5'- AGACTCTTTGGTGGGAAGCC -3'
(R):5'- AAAGGCATCAAGGAGTCTTCC -3'

Sequencing Primer
(F):5'- TGGGAAGCCTACCAAGCC -3'
(R):5'- AGGAGTTGTGGCTCAAGC -3'
Posted On 2019-09-13