Incidental Mutation 'R7337:Piezo1'
ID 569588
Institutional Source Beutler Lab
Gene Symbol Piezo1
Ensembl Gene ENSMUSG00000014444
Gene Name piezo-type mechanosensitive ion channel component 1
Synonyms Fam38a, Piezo1
MMRRC Submission 045427-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7337 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 123208437-123278068 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 123212463 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Asparagine at position 1955 (Y1955N)
Ref Sequence ENSEMBL: ENSMUSP00000114584 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067252] [ENSMUST00000116412] [ENSMUST00000127664] [ENSMUST00000128383] [ENSMUST00000136253] [ENSMUST00000151855] [ENSMUST00000156333]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000067252
AA Change: Y1954N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000089777
Gene: ENSMUSG00000014444
AA Change: Y1954N

DomainStartEndE-ValueType
transmembrane domain 5 24 N/A INTRINSIC
transmembrane domain 29 46 N/A INTRINSIC
transmembrane domain 59 81 N/A INTRINSIC
transmembrane domain 121 143 N/A INTRINSIC
low complexity region 156 169 N/A INTRINSIC
transmembrane domain 211 233 N/A INTRINSIC
transmembrane domain 248 270 N/A INTRINSIC
transmembrane domain 316 333 N/A INTRINSIC
low complexity region 353 368 N/A INTRINSIC
low complexity region 396 408 N/A INTRINSIC
transmembrane domain 433 455 N/A INTRINSIC
transmembrane domain 468 490 N/A INTRINSIC
transmembrane domain 513 535 N/A INTRINSIC
internal_repeat_1 541 658 5.31e-5 PROSPERO
transmembrane domain 685 707 N/A INTRINSIC
low complexity region 738 753 N/A INTRINSIC
transmembrane domain 817 839 N/A INTRINSIC
transmembrane domain 844 866 N/A INTRINSIC
low complexity region 940 952 N/A INTRINSIC
transmembrane domain 979 1001 N/A INTRINSIC
transmembrane domain 1005 1022 N/A INTRINSIC
transmembrane domain 1035 1057 N/A INTRINSIC
transmembrane domain 1154 1171 N/A INTRINSIC
transmembrane domain 1178 1197 N/A INTRINSIC
Pfam:PIEZO 1229 1458 1.1e-97 PFAM
low complexity region 1475 1486 N/A INTRINSIC
internal_repeat_1 1646 1752 5.31e-5 PROSPERO
low complexity region 1905 1921 N/A INTRINSIC
transmembrane domain 1976 1998 N/A INTRINSIC
transmembrane domain 2018 2038 N/A INTRINSIC
transmembrane domain 2045 2067 N/A INTRINSIC
transmembrane domain 2077 2094 N/A INTRINSIC
Pfam:Piezo_RRas_bdg 2126 2544 3.2e-157 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000116412
SMART Domains Protein: ENSMUSP00000112113
Gene: ENSMUSG00000049482

DomainStartEndE-ValueType
low complexity region 11 24 N/A INTRINSIC
SCOP:d1sur__ 47 153 1e-3 SMART
Pfam:CTU2 347 470 2.3e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128383
SMART Domains Protein: ENSMUSP00000116194
Gene: ENSMUSG00000014444

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
transmembrane domain 31 53 N/A INTRINSIC
transmembrane domain 75 97 N/A INTRINSIC
transmembrane domain 143 165 N/A INTRINSIC
transmembrane domain 169 188 N/A INTRINSIC
transmembrane domain 195 217 N/A INTRINSIC
transmembrane domain 247 269 N/A INTRINSIC
low complexity region 300 315 N/A INTRINSIC
transmembrane domain 379 401 N/A INTRINSIC
transmembrane domain 406 428 N/A INTRINSIC
low complexity region 502 514 N/A INTRINSIC
transmembrane domain 541 563 N/A INTRINSIC
transmembrane domain 567 584 N/A INTRINSIC
transmembrane domain 597 619 N/A INTRINSIC
transmembrane domain 716 733 N/A INTRINSIC
transmembrane domain 740 759 N/A INTRINSIC
transmembrane domain 774 796 N/A INTRINSIC
transmembrane domain 803 820 N/A INTRINSIC
low complexity region 848 859 N/A INTRINSIC
coiled coil region 895 926 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136253
Predicted Effect probably benign
Transcript: ENSMUST00000148497
SMART Domains Protein: ENSMUSP00000121725
Gene: ENSMUSG00000014444

DomainStartEndE-ValueType
transmembrane domain 33 55 N/A INTRINSIC
low complexity region 86 101 N/A INTRINSIC
transmembrane domain 165 187 N/A INTRINSIC
low complexity region 288 300 N/A INTRINSIC
transmembrane domain 351 373 N/A INTRINSIC
transmembrane domain 386 408 N/A INTRINSIC
transmembrane domain 505 522 N/A INTRINSIC
transmembrane domain 529 548 N/A INTRINSIC
Pfam:PIEZO 580 809 3.2e-98 PFAM
low complexity region 826 837 N/A INTRINSIC
low complexity region 1003 1020 N/A INTRINSIC
low complexity region 1046 1063 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151855
SMART Domains Protein: ENSMUSP00000133622
Gene: ENSMUSG00000049482

DomainStartEndE-ValueType
low complexity region 11 24 N/A INTRINSIC
SCOP:d1sur__ 47 153 9e-4 SMART
Pfam:DUF2392 277 377 1.7e-30 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000114584
Gene: ENSMUSG00000014444
AA Change: Y1955N

DomainStartEndE-ValueType
transmembrane domain 5 24 N/A INTRINSIC
transmembrane domain 29 46 N/A INTRINSIC
transmembrane domain 59 81 N/A INTRINSIC
transmembrane domain 121 143 N/A INTRINSIC
low complexity region 157 170 N/A INTRINSIC
transmembrane domain 212 234 N/A INTRINSIC
transmembrane domain 249 271 N/A INTRINSIC
transmembrane domain 317 334 N/A INTRINSIC
low complexity region 354 369 N/A INTRINSIC
low complexity region 397 409 N/A INTRINSIC
transmembrane domain 434 456 N/A INTRINSIC
transmembrane domain 469 491 N/A INTRINSIC
transmembrane domain 514 536 N/A INTRINSIC
internal_repeat_1 542 659 4.88e-5 PROSPERO
transmembrane domain 686 708 N/A INTRINSIC
low complexity region 739 754 N/A INTRINSIC
transmembrane domain 818 840 N/A INTRINSIC
transmembrane domain 845 867 N/A INTRINSIC
low complexity region 941 953 N/A INTRINSIC
transmembrane domain 980 1002 N/A INTRINSIC
transmembrane domain 1006 1023 N/A INTRINSIC
transmembrane domain 1036 1058 N/A INTRINSIC
transmembrane domain 1155 1172 N/A INTRINSIC
transmembrane domain 1179 1198 N/A INTRINSIC
Pfam:PIEZO 1230 1459 2.3e-94 PFAM
low complexity region 1476 1487 N/A INTRINSIC
internal_repeat_1 1647 1753 4.88e-5 PROSPERO
low complexity region 1906 1922 N/A INTRINSIC
transmembrane domain 1977 1999 N/A INTRINSIC
transmembrane domain 2019 2039 N/A INTRINSIC
transmembrane domain 2046 2068 N/A INTRINSIC
transmembrane domain 2078 2095 N/A INTRINSIC
Pfam:Piezo_RRas_bdg 2127 2545 8.7e-154 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000212499
Meta Mutation Damage Score 0.4396 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (88/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a mechanically-activated ion channel that links mechanical forces to biological signals. The encoded protein contains 36 transmembrane domains and functions as a homotetramer. Defects in this gene have been associated with dehydrated hereditary stomatocytosis. [provided by RefSeq, Jul 2015]
PHENOTYPE: Most mice homozygous for a gene trapped allele die at midgestation, exhibiting embryonic growth retardation, pericardial effusion, and vascular remodeling defects in the yolk sac and the embryo proper. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 A T 2: 69,076,113 (GRCm39) H1198Q probably damaging Het
Adamts14 A G 10: 61,043,239 (GRCm39) V743A probably damaging Het
Adgrg6 A G 10: 14,343,095 (GRCm39) V284A possibly damaging Het
Alb A G 5: 90,622,452 (GRCm39) K560R probably damaging Het
Aqp9 A T 9: 71,069,764 (GRCm39) F8L probably benign Het
Arhgef7 T C 8: 11,835,789 (GRCm39) L182P probably damaging Het
Atr A G 9: 95,753,501 (GRCm39) D701G probably damaging Het
Calr3 C T 8: 73,185,339 (GRCm39) D187N probably damaging Het
Ccdc198 A G 14: 49,471,948 (GRCm39) M163T possibly damaging Het
Ccdc65 A G 15: 98,618,977 (GRCm39) T319A probably benign Het
Ccdc66 A T 14: 27,222,290 (GRCm39) L151H probably damaging Het
Ces2e T A 8: 105,657,688 (GRCm39) probably null Het
Cfap46 A G 7: 139,210,492 (GRCm39) probably null Het
Cfap74 A G 4: 155,544,472 (GRCm39) T1034A unknown Het
Cldnd1 T G 16: 58,549,322 (GRCm39) probably null Het
Clec4f C A 6: 83,630,190 (GRCm39) V123L probably benign Het
Cntn6 C T 6: 104,627,491 (GRCm39) T108I probably damaging Het
Crygn T G 5: 24,961,147 (GRCm39) D53A possibly damaging Het
Cyp27a1 T A 1: 74,774,594 (GRCm39) V204E probably damaging Het
Cyp2c67 A T 19: 39,597,708 (GRCm39) probably null Het
Ddb1 T C 19: 10,605,195 (GRCm39) V1061A possibly damaging Het
Dnah12 G T 14: 26,488,534 (GRCm39) probably null Het
Draxin T C 4: 148,197,216 (GRCm39) T194A probably benign Het
Drosha T A 15: 12,846,285 (GRCm39) D473E possibly damaging Het
Ecpas T C 4: 58,827,047 (GRCm39) T1029A possibly damaging Het
G6pd2 T A 5: 61,967,562 (GRCm39) C446S probably benign Het
Gm29106 C T 1: 118,104,642 (GRCm39) S3L unknown Het
Grin3a T C 4: 49,702,762 (GRCm39) Y908C probably damaging Het
Ints2 G A 11: 86,108,668 (GRCm39) A893V probably benign Het
Ippk C T 13: 49,602,767 (GRCm39) T371I probably benign Het
Irf2 T A 8: 47,260,316 (GRCm39) C83S probably damaging Het
Jph3 C T 8: 122,480,441 (GRCm39) A373V probably benign Het
Kcnj6 C T 16: 94,634,073 (GRCm39) V13I probably benign Het
Lama3 T C 18: 12,640,097 (GRCm39) probably null Het
Lmo7 A T 14: 102,121,640 (GRCm39) Q235L probably damaging Het
Marchf7 A G 2: 60,071,189 (GRCm39) probably null Het
Mfsd6l A T 11: 68,448,109 (GRCm39) Y320F possibly damaging Het
Mroh1 T A 15: 76,335,676 (GRCm39) W1440R probably benign Het
Mrps17 G A 5: 129,793,863 (GRCm39) G19D probably damaging Het
Myt1 A G 2: 181,444,756 (GRCm39) H566R possibly damaging Het
Nav2 T C 7: 49,201,521 (GRCm39) L176P possibly damaging Het
Nop58 T A 1: 59,737,599 (GRCm39) C139S probably benign Het
Nsd1 A G 13: 55,394,022 (GRCm39) D644G probably damaging Het
Nsd2 T A 5: 34,042,816 (GRCm39) C1027S probably damaging Het
Nsmce2 A G 15: 59,473,265 (GRCm39) I235V probably damaging Het
Nyap2 T C 1: 81,314,230 (GRCm39) V642A possibly damaging Het
Or14n1-ps1 A T 7: 86,092,328 (GRCm39) L46F unknown Het
Or8g51 A G 9: 38,609,161 (GRCm39) V167A probably benign Het
Paqr7 A G 4: 134,234,431 (GRCm39) D96G probably benign Het
Parp4 A G 14: 56,839,852 (GRCm39) Y520C probably damaging Het
Pde5a A G 3: 122,542,107 (GRCm39) N199S probably damaging Het
Pnma8a A G 7: 16,695,315 (GRCm39) K390R probably benign Het
Prdm10 G T 9: 31,227,537 (GRCm39) Q47H probably damaging Het
Psg22 T A 7: 18,453,499 (GRCm39) F104I probably benign Het
Ptprf T C 4: 118,068,322 (GRCm39) E1738G probably damaging Het
Rad21l A T 2: 151,500,365 (GRCm39) L218Q probably damaging Het
Rad54l2 A G 9: 106,583,024 (GRCm39) I798T probably damaging Het
Rgs5 G T 1: 169,483,149 (GRCm39) M1I probably null Het
Rhbdl2 T C 4: 123,711,659 (GRCm39) V132A possibly damaging Het
Rmi1 T A 13: 58,557,393 (GRCm39) Y547* probably null Het
Rptn A T 3: 93,304,212 (GRCm39) D515V probably benign Het
Rsph10b A G 5: 143,898,033 (GRCm39) N505D probably benign Het
Samhd1 T C 2: 156,948,164 (GRCm39) D539G probably damaging Het
Scube3 A T 17: 28,387,156 (GRCm39) I885F probably damaging Het
Sfmbt1 A G 14: 30,506,696 (GRCm39) I247V possibly damaging Het
Slc25a21 T C 12: 56,904,828 (GRCm39) I62V probably benign Het
Slc4a11 T A 2: 130,527,452 (GRCm39) N648Y probably damaging Het
Slc7a11 A G 3: 50,397,448 (GRCm39) V88A possibly damaging Het
Slc7a8 A C 14: 54,964,263 (GRCm39) F397V possibly damaging Het
Sox12 A C 2: 152,239,377 (GRCm39) L81R probably damaging Het
Spg11 T C 2: 121,915,474 (GRCm39) I1057V probably benign Het
St8sia3 G A 18: 64,402,987 (GRCm39) V265I probably benign Het
Stxbp5 A G 10: 9,684,874 (GRCm39) S509P possibly damaging Het
Svep1 T C 4: 58,108,323 (GRCm39) Y1129C probably damaging Het
Tenm4 G T 7: 96,523,333 (GRCm39) R1625L probably benign Het
Tlr4 T C 4: 66,758,191 (GRCm39) F328S possibly damaging Het
Tmprss15 T C 16: 78,868,164 (GRCm39) T215A probably benign Het
Tmprss9 A T 10: 80,718,504 (GRCm39) I62L probably benign Het
Trpm5 C T 7: 142,642,756 (GRCm39) A64T probably benign Het
Txk A C 5: 72,889,109 (GRCm39) Y148* probably null Het
Uba5 C T 9: 103,932,454 (GRCm39) G170R possibly damaging Het
Uggt2 A T 14: 119,323,587 (GRCm39) D231E probably benign Het
Ulk4 A T 9: 121,077,993 (GRCm39) D525E probably benign Het
Vmn1r158 T A 7: 22,489,649 (GRCm39) T187S probably benign Het
Vmn1r52 T A 6: 90,156,605 (GRCm39) M303K probably benign Het
Vmn2r54 A G 7: 12,356,044 (GRCm39) F454S probably benign Het
Zbp1 A T 2: 173,060,546 (GRCm39) L8* probably null Het
Zmym2 A T 14: 57,181,557 (GRCm39) D924V probably benign Het
Other mutations in Piezo1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00896:Piezo1 APN 8 123,224,609 (GRCm39) missense possibly damaging 0.91
IGL01094:Piezo1 APN 8 123,208,877 (GRCm39) missense probably damaging 0.99
IGL01321:Piezo1 APN 8 123,214,339 (GRCm39) missense probably damaging 0.99
IGL01695:Piezo1 APN 8 123,222,248 (GRCm39) missense possibly damaging 0.81
IGL01762:Piezo1 APN 8 123,214,668 (GRCm39) nonsense probably null
IGL01922:Piezo1 APN 8 123,219,431 (GRCm39) missense probably benign 0.41
IGL01953:Piezo1 APN 8 123,217,923 (GRCm39) missense probably damaging 1.00
IGL01997:Piezo1 APN 8 123,215,070 (GRCm39) splice site probably benign
IGL02381:Piezo1 APN 8 123,225,283 (GRCm39) missense probably benign 0.28
IGL02398:Piezo1 APN 8 123,213,302 (GRCm39) missense probably benign 0.21
IGL02562:Piezo1 APN 8 123,223,502 (GRCm39) missense probably benign 0.11
IGL02572:Piezo1 APN 8 123,212,044 (GRCm39) missense probably benign 0.28
IGL02691:Piezo1 APN 8 123,228,688 (GRCm39) missense possibly damaging 0.58
IGL02726:Piezo1 APN 8 123,213,894 (GRCm39) missense probably damaging 0.99
IGL02814:Piezo1 APN 8 123,224,954 (GRCm39) missense probably damaging 1.00
IGL02931:Piezo1 APN 8 123,210,258 (GRCm39) missense probably damaging 1.00
IGL03145:Piezo1 APN 8 123,209,660 (GRCm39) missense probably benign 0.14
FR4449:Piezo1 UTSW 8 123,222,308 (GRCm39) missense probably damaging 1.00
FR4548:Piezo1 UTSW 8 123,222,308 (GRCm39) missense probably damaging 1.00
FR4737:Piezo1 UTSW 8 123,222,308 (GRCm39) missense probably damaging 1.00
FR4976:Piezo1 UTSW 8 123,222,308 (GRCm39) missense probably damaging 1.00
LCD18:Piezo1 UTSW 8 123,222,308 (GRCm39) missense probably damaging 1.00
R0085:Piezo1 UTSW 8 123,228,354 (GRCm39) missense probably damaging 0.98
R0096:Piezo1 UTSW 8 123,212,109 (GRCm39) unclassified probably benign
R0970:Piezo1 UTSW 8 123,213,549 (GRCm39) missense possibly damaging 0.94
R1364:Piezo1 UTSW 8 123,225,310 (GRCm39) missense possibly damaging 0.61
R1460:Piezo1 UTSW 8 123,228,890 (GRCm39) missense possibly damaging 0.86
R1485:Piezo1 UTSW 8 123,208,788 (GRCm39) missense probably damaging 1.00
R1538:Piezo1 UTSW 8 123,218,142 (GRCm39) missense probably damaging 1.00
R1655:Piezo1 UTSW 8 123,223,561 (GRCm39) missense probably benign 0.09
R1700:Piezo1 UTSW 8 123,214,241 (GRCm39) missense probably damaging 1.00
R1860:Piezo1 UTSW 8 123,222,489 (GRCm39) missense possibly damaging 0.90
R1861:Piezo1 UTSW 8 123,222,489 (GRCm39) missense possibly damaging 0.90
R1899:Piezo1 UTSW 8 123,216,305 (GRCm39) missense probably damaging 1.00
R1899:Piezo1 UTSW 8 123,209,384 (GRCm39) unclassified probably benign
R1900:Piezo1 UTSW 8 123,209,384 (GRCm39) unclassified probably benign
R2018:Piezo1 UTSW 8 123,209,451 (GRCm39) missense probably benign 0.43
R2019:Piezo1 UTSW 8 123,209,451 (GRCm39) missense probably benign 0.43
R2219:Piezo1 UTSW 8 123,218,227 (GRCm39) missense probably benign 0.01
R2331:Piezo1 UTSW 8 123,214,005 (GRCm39) splice site probably null
R3016:Piezo1 UTSW 8 123,232,766 (GRCm39) critical splice donor site probably null
R3699:Piezo1 UTSW 8 123,221,642 (GRCm39) missense probably damaging 1.00
R3700:Piezo1 UTSW 8 123,221,642 (GRCm39) missense probably damaging 1.00
R3746:Piezo1 UTSW 8 123,219,377 (GRCm39) missense probably damaging 1.00
R3905:Piezo1 UTSW 8 123,208,882 (GRCm39) missense probably damaging 1.00
R4093:Piezo1 UTSW 8 123,227,899 (GRCm39) critical splice donor site probably null
R4296:Piezo1 UTSW 8 123,217,866 (GRCm39) missense probably damaging 1.00
R4396:Piezo1 UTSW 8 123,225,413 (GRCm39) missense probably damaging 0.98
R4467:Piezo1 UTSW 8 123,213,135 (GRCm39) missense probably benign 0.17
R4614:Piezo1 UTSW 8 123,213,150 (GRCm39) missense probably benign 0.25
R4642:Piezo1 UTSW 8 123,222,193 (GRCm39) missense probably damaging 1.00
R4688:Piezo1 UTSW 8 123,215,278 (GRCm39) missense probably damaging 1.00
R4734:Piezo1 UTSW 8 123,224,945 (GRCm39) missense probably damaging 1.00
R4749:Piezo1 UTSW 8 123,224,945 (GRCm39) missense probably damaging 1.00
R4749:Piezo1 UTSW 8 123,213,678 (GRCm39) missense possibly damaging 0.48
R4865:Piezo1 UTSW 8 123,213,660 (GRCm39) missense probably damaging 1.00
R4869:Piezo1 UTSW 8 123,214,284 (GRCm39) missense probably benign
R4962:Piezo1 UTSW 8 123,213,220 (GRCm39) missense probably benign 0.41
R5026:Piezo1 UTSW 8 123,213,557 (GRCm39) missense probably benign 0.11
R5418:Piezo1 UTSW 8 123,213,519 (GRCm39) missense probably damaging 1.00
R5625:Piezo1 UTSW 8 123,209,699 (GRCm39) missense probably benign 0.01
R5759:Piezo1 UTSW 8 123,234,394 (GRCm39) missense probably damaging 0.98
R5864:Piezo1 UTSW 8 123,213,112 (GRCm39) missense possibly damaging 0.75
R5898:Piezo1 UTSW 8 123,214,682 (GRCm39) missense probably benign 0.00
R5948:Piezo1 UTSW 8 123,210,086 (GRCm39) missense probably benign 0.01
R6052:Piezo1 UTSW 8 123,233,008 (GRCm39) missense probably damaging 1.00
R6086:Piezo1 UTSW 8 123,228,396 (GRCm39) missense possibly damaging 0.73
R6216:Piezo1 UTSW 8 123,215,869 (GRCm39) missense probably benign 0.05
R6271:Piezo1 UTSW 8 123,221,671 (GRCm39) missense probably damaging 1.00
R6549:Piezo1 UTSW 8 123,227,002 (GRCm39) missense
R6723:Piezo1 UTSW 8 123,234,366 (GRCm39) missense probably benign 0.15
R6871:Piezo1 UTSW 8 123,211,766 (GRCm39) splice site probably null
R6919:Piezo1 UTSW 8 123,217,020 (GRCm39) missense probably damaging 1.00
R7085:Piezo1 UTSW 8 123,217,633 (GRCm39) missense
R7105:Piezo1 UTSW 8 123,208,857 (GRCm39) missense unknown
R7267:Piezo1 UTSW 8 123,224,268 (GRCm39) missense
R7381:Piezo1 UTSW 8 123,228,397 (GRCm39) missense
R7480:Piezo1 UTSW 8 123,225,234 (GRCm39) nonsense probably null
R7515:Piezo1 UTSW 8 123,212,035 (GRCm39) missense
R7571:Piezo1 UTSW 8 123,225,157 (GRCm39) missense
R7601:Piezo1 UTSW 8 123,210,220 (GRCm39) splice site probably null
R7827:Piezo1 UTSW 8 123,209,659 (GRCm39) missense probably damaging 0.96
R7923:Piezo1 UTSW 8 123,223,183 (GRCm39) missense
R7975:Piezo1 UTSW 8 123,222,504 (GRCm39) missense
R8071:Piezo1 UTSW 8 123,213,750 (GRCm39) missense probably null
R8231:Piezo1 UTSW 8 123,232,836 (GRCm39) missense
R8270:Piezo1 UTSW 8 123,228,298 (GRCm39) missense
R8784:Piezo1 UTSW 8 123,223,328 (GRCm39) splice site probably benign
R8788:Piezo1 UTSW 8 123,228,533 (GRCm39) missense
R8829:Piezo1 UTSW 8 123,217,753 (GRCm39) missense
R8890:Piezo1 UTSW 8 123,216,330 (GRCm39) missense
R8950:Piezo1 UTSW 8 123,208,729 (GRCm39) missense probably benign 0.01
R8994:Piezo1 UTSW 8 123,209,829 (GRCm39) missense unknown
R9036:Piezo1 UTSW 8 123,215,090 (GRCm39) missense
R9145:Piezo1 UTSW 8 123,208,753 (GRCm39) missense unknown
R9146:Piezo1 UTSW 8 123,227,002 (GRCm39) missense
R9251:Piezo1 UTSW 8 123,219,354 (GRCm39) missense
R9307:Piezo1 UTSW 8 123,213,832 (GRCm39) missense
R9375:Piezo1 UTSW 8 123,228,604 (GRCm39) missense
R9424:Piezo1 UTSW 8 123,218,079 (GRCm39) missense
R9578:Piezo1 UTSW 8 123,224,214 (GRCm39) missense
R9722:Piezo1 UTSW 8 123,225,497 (GRCm39) missense
R9775:Piezo1 UTSW 8 123,208,927 (GRCm39) missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TTAGAGGCCAGCCATCTGTG -3'
(R):5'- CTGGTACTTCCCTGGACATAC -3'

Sequencing Primer
(F):5'- ATCTGTGCTGGGGCCTCAG -3'
(R):5'- GGTACTTCCCTGGACATACATACC -3'
Posted On 2019-09-13