Mutagenetix > Incidental Mutation

Incidental Mutation 'R7337:Nsd1'

569603

Institutional Source

Beutler Lab

Gene Symbol

Nsd1

Ensembl Gene

ENSMUSG00000021488

Gene Name

nuclear receptor-binding SET-domain protein 1

Synonyms

KMT3B

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7337 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

55209782-55318325 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 55246209 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 644 (D644G)

Ref Sequence

ENSEMBL: ENSMUSP00000097089 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099490] [ENSMUST00000224973]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000099490
AA Change: D644G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000097089
Gene: ENSMUSG00000021488
AA Change: D644G

Domain	Start	End	E-Value	Type
low complexity region	177	187	N/A	INTRINSIC
low complexity region	281	289	N/A	INTRINSIC
PWWP	322	388	1.97e-3	SMART
low complexity region	635	644	N/A	INTRINSIC
low complexity region	980	1000	N/A	INTRINSIC
low complexity region	1296	1309	N/A	INTRINSIC
PHD	1546	1588	4.25e-8	SMART
PHD	1593	1640	3.79e-5	SMART
RING	1594	1639	1.08e-1	SMART
PHD	1641	1694	1.09e1	SMART
PHD	1710	1750	1.02e-10	SMART
PWWP	1755	1817	8.87e-29	SMART
AWS	1891	1942	3.02e-22	SMART
SET	1943	2066	1e-45	SMART
PostSET	2067	2083	3.99e-3	SMART
PHD	2121	2164	1.08e-9	SMART
low complexity region	2224	2237	N/A	INTRINSIC
low complexity region	2276	2286	N/A	INTRINSIC
low complexity region	2335	2356	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000224973
AA Change: D541G

PolyPhen 2 Score 0.113 (Sensitivity: 0.93; Specificity: 0.86)

Meta Mutation Damage Score

0.0841

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (88/88)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a SET domain, 2 LXXLL motifs, 3 nuclear translocation signals (NLSs), 4 plant homeodomain (PHD) finger regions, and a proline-rich region. The encoded protein enhances androgen receptor (AR) transactivation, and this enhancement can be increased further in the presence of other androgen receptor associated coregulators. This protein may act as a nucleus-localized, basic transcriptional factor and also as a bifunctional transcriptional regulator. Mutations of this gene have been associated with Sotos syndrome and Weaver syndrome. One version of childhood acute myeloid leukemia is the result of a cryptic translocation with the breakpoints occurring within nuclear receptor-binding Su-var, enhancer of zeste, and trithorax domain protein 1 on chromosome 5 and nucleoporin, 98-kd on chromosome 11. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit excess apoptosis and retarded growth, fail to complete gastrulation, and are resorbed by embryonic day 10. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 88 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700011H14Rik	A	G	14: 49,234,491	M163T	possibly damaging	Het
Abcb11	A	T	2: 69,245,769	H1198Q	probably damaging	Het
Adamts14	A	G	10: 61,207,460	V743A	probably damaging	Het
Adgrg6	A	G	10: 14,467,351	V284A	possibly damaging	Het
AI314180	T	C	4: 58,827,047	T1029A	possibly damaging	Het
Alb	A	G	5: 90,474,593	K560R	probably damaging	Het
Aqp9	A	T	9: 71,162,482	F8L	probably benign	Het
Arhgef7	T	C	8: 11,785,789	L182P	probably damaging	Het
Atr	A	G	9: 95,871,448	D701G	probably damaging	Het
Calr3	C	T	8: 72,431,495	D187N	probably damaging	Het
Ccdc65	A	G	15: 98,721,096	T319A	probably benign	Het
Ccdc66	A	T	14: 27,500,333	L151H	probably damaging	Het
Ces2e	T	A	8: 104,931,056		probably null	Het
Cfap46	A	G	7: 139,630,576		probably null	Het
Cfap74	A	G	4: 155,460,015	T1034A	unknown	Het
Cldnd1	T	G	16: 58,728,959		probably null	Het
Clec4f	C	A	6: 83,653,208	V123L	probably benign	Het
Cntn6	C	T	6: 104,650,530	T108I	probably damaging	Het
Crygn	T	G	5: 24,756,149	D53A	possibly damaging	Het
Cyp27a1	T	A	1: 74,735,435	V204E	probably damaging	Het
Cyp2c67	A	T	19: 39,609,264		probably null	Het
Ddb1	T	C	19: 10,627,831	V1061A	possibly damaging	Het
Dnah12	G	T	14: 26,766,577		probably null	Het
Draxin	T	C	4: 148,112,759	T194A	probably benign	Het
Drosha	T	A	15: 12,846,199	D473E	possibly damaging	Het
G6pd2	T	A	5: 61,810,219	C446S	probably benign	Het
Gm29106	C	T	1: 118,176,912	S3L	unknown	Het
Grin3a	T	C	4: 49,702,762	Y908C	probably damaging	Het
Ints2	G	A	11: 86,217,842	A893V	probably benign	Het
Ippk	C	T	13: 49,449,291	T371I	probably benign	Het
Irf2	T	A	8: 46,807,281	C83S	probably damaging	Het
Jph3	C	T	8: 121,753,702	A373V	probably benign	Het
Kcnj6	C	T	16: 94,833,214	V13I	probably benign	Het
Lama3	T	C	18: 12,507,040		probably null	Het
Lmo7	A	T	14: 101,884,204	Q235L	probably damaging	Het
March7	A	G	2: 60,240,845		probably null	Het
Mfsd6l	A	T	11: 68,557,283	Y320F	possibly damaging	Het
Mroh1	T	A	15: 76,451,476	W1440R	probably benign	Het
Mrps17	G	A	5: 129,716,799	G19D	probably damaging	Het
Myt1	A	G	2: 181,802,963	H566R	possibly damaging	Het
Nav2	T	C	7: 49,551,773	L176P	possibly damaging	Het
Nop58	T	A	1: 59,698,440	C139S	probably benign	Het
Nsd2	T	A	5: 33,885,472	C1027S	probably damaging	Het
Nsmce2	A	G	15: 59,601,416	I235V	probably damaging	Het
Nyap2	T	C	1: 81,336,515	V642A	possibly damaging	Het
Olfr300-ps1	A	T	7: 86,443,120	L46F	unknown	Het
Olfr919	A	G	9: 38,697,865	V167A	probably benign	Het
Paqr7	A	G	4: 134,507,120	D96G	probably benign	Het
Parp4	A	G	14: 56,602,395	Y520C	probably damaging	Het
Pde5a	A	G	3: 122,748,458	N199S	probably damaging	Het
Piezo1	A	T	8: 122,485,724	Y1955N		Het
Pnmal1	A	G	7: 16,961,390	K390R	probably benign	Het
Prdm10	G	T	9: 31,316,241	Q47H	probably damaging	Het
Psg22	T	A	7: 18,719,574	F104I	probably benign	Het
Ptprf	T	C	4: 118,211,125	E1738G	probably damaging	Het
Rad21l	A	T	2: 151,658,445	L218Q	probably damaging	Het
Rad54l2	A	G	9: 106,705,825	I798T	probably damaging	Het
Rgs5	G	T	1: 169,655,580	M1I	probably null	Het
Rhbdl2	T	C	4: 123,817,866	V132A	possibly damaging	Het
Rmi1	T	A	13: 58,409,579	Y547*	probably null	Het
Rptn	A	T	3: 93,396,905	D515V	probably benign	Het
Rsph10b	A	G	5: 143,961,215	N505D	probably benign	Het
Samhd1	T	C	2: 157,106,244	D539G	probably damaging	Het
Scube3	A	T	17: 28,168,182	I885F	probably damaging	Het
Sfmbt1	A	G	14: 30,784,739	I247V	possibly damaging	Het
Slc25a21	T	C	12: 56,858,043	I62V	probably benign	Het
Slc4a11	T	A	2: 130,685,532	N648Y	probably damaging	Het
Slc7a11	A	G	3: 50,442,999	V88A	possibly damaging	Het
Slc7a8	A	C	14: 54,726,806	F397V	possibly damaging	Het
Sox12	A	C	2: 152,397,457	L81R	probably damaging	Het
Spg11	T	C	2: 122,084,993	I1057V	probably benign	Het
St8sia3	G	A	18: 64,269,916	V265I	probably benign	Het
Stxbp5	A	G	10: 9,809,130	S509P	possibly damaging	Het
Svep1	T	C	4: 58,108,323	Y1129C	probably damaging	Het
Tenm4	G	T	7: 96,874,126	R1625L	probably benign	Het
Tlr4	T	C	4: 66,839,954	F328S	possibly damaging	Het
Tmprss15	T	C	16: 79,071,276	T215A	probably benign	Het
Tmprss9	A	T	10: 80,882,670	I62L	probably benign	Het
Trpm5	C	T	7: 143,089,019	A64T	probably benign	Het
Txk	A	C	5: 72,731,766	Y148*	probably null	Het
Uba5	C	T	9: 104,055,255	G170R	possibly damaging	Het
Uggt2	A	T	14: 119,086,175	D231E	probably benign	Het
Ulk4	A	T	9: 121,248,927	D525E	probably benign	Het
Vmn1r158	T	A	7: 22,790,224	T187S	probably benign	Het
Vmn1r52	T	A	6: 90,179,623	M303K	probably benign	Het
Vmn2r54	A	G	7: 12,622,117	F454S	probably benign	Het
Zbp1	A	T	2: 173,218,753	L8*	probably null	Het
Zmym2	A	T	14: 56,944,100	D924V	probably benign	Het

Other mutations in Nsd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00777:Nsd1	APN	13	55238735	missense	probably damaging	1.00
IGL01060:Nsd1	APN	13	55263429	missense	probably damaging	1.00
IGL01125:Nsd1	APN	13	55245617	missense	probably damaging	1.00
IGL01746:Nsd1	APN	13	55276515	splice site	probably null
IGL02437:Nsd1	APN	13	55313441	missense	probably damaging	1.00
IGL02530:Nsd1	APN	13	55302833	splice site	probably benign
IGL02557:Nsd1	APN	13	55312448	missense	probably damaging	1.00
IGL02572:Nsd1	APN	13	55296130	missense	probably damaging	1.00
IGL02665:Nsd1	APN	13	55296183	missense	probably damaging	1.00
IGL02870:Nsd1	APN	13	55313603	missense	probably benign	0.06
IGL03181:Nsd1	APN	13	55247045	missense	probably damaging	1.00
Amanuensis	UTSW	13	55261626	nonsense	probably null
handwriting	UTSW	13	55313546	missense
Prothonotary	UTSW	13	55282757	missense	probably damaging	1.00
scribe	UTSW	13	55291236	missense	probably damaging	1.00
stenographer	UTSW	13	55298376	splice site	probably null
PIT4480001:Nsd1	UTSW	13	55213918	missense	probably benign	0.11
R0316:Nsd1	UTSW	13	55213771	missense	probably damaging	0.98
R0519:Nsd1	UTSW	13	55312835	missense	probably benign	0.04
R0542:Nsd1	UTSW	13	55260458	missense	possibly damaging	0.93
R0563:Nsd1	UTSW	13	55246578	missense	possibly damaging	0.48
R0652:Nsd1	UTSW	13	55247586	missense	possibly damaging	0.92
R0906:Nsd1	UTSW	13	55277590	missense	probably benign	0.30
R1560:Nsd1	UTSW	13	55246720	nonsense	probably null
R1572:Nsd1	UTSW	13	55246969	missense	probably damaging	0.98
R1693:Nsd1	UTSW	13	55247261	missense	probably benign
R1697:Nsd1	UTSW	13	55214059	critical splice acceptor site	probably null
R1720:Nsd1	UTSW	13	55246898	missense	probably damaging	0.98
R1829:Nsd1	UTSW	13	55246369	missense	probably damaging	1.00
R1834:Nsd1	UTSW	13	55313351	missense	possibly damaging	0.52
R1842:Nsd1	UTSW	13	55246445	missense	probably damaging	1.00
R1880:Nsd1	UTSW	13	55213793	missense	probably damaging	0.99
R2022:Nsd1	UTSW	13	55213279	missense	probably damaging	0.99
R2075:Nsd1	UTSW	13	55310500	missense	possibly damaging	0.74
R2143:Nsd1	UTSW	13	55260397	missense	probably damaging	1.00
R2151:Nsd1	UTSW	13	55291236	missense	probably damaging	1.00
R2316:Nsd1	UTSW	13	55233966	missense	probably damaging	1.00
R2359:Nsd1	UTSW	13	55213711	missense	possibly damaging	0.90
R2361:Nsd1	UTSW	13	55213711	missense	possibly damaging	0.90
R2656:Nsd1	UTSW	13	55246868	missense	probably damaging	1.00
R2849:Nsd1	UTSW	13	55213692	missense	probably damaging	0.99
R3237:Nsd1	UTSW	13	55312888	missense	possibly damaging	0.92
R3772:Nsd1	UTSW	13	55246673	missense	probably benign	0.00
R3773:Nsd1	UTSW	13	55246673	missense	probably benign	0.00
R3849:Nsd1	UTSW	13	55246691	missense	probably benign	0.00
R3951:Nsd1	UTSW	13	55268454	missense	probably benign	0.05
R4036:Nsd1	UTSW	13	55213711	missense	possibly damaging	0.90
R4073:Nsd1	UTSW	13	55247728	missense	probably benign	0.28
R4080:Nsd1	UTSW	13	55301809	missense	probably damaging	0.96
R4226:Nsd1	UTSW	13	55260401	missense	probably damaging	1.00
R4485:Nsd1	UTSW	13	55245621	missense	probably benign
R4703:Nsd1	UTSW	13	55214063	missense	probably damaging	1.00
R4853:Nsd1	UTSW	13	55268504	missense	probably benign	0.30
R4915:Nsd1	UTSW	13	55247868	missense	possibly damaging	0.65
R4915:Nsd1	UTSW	13	55276528	missense	probably benign	0.00
R5264:Nsd1	UTSW	13	55247346	missense	possibly damaging	0.49
R5348:Nsd1	UTSW	13	55312334	missense	probably benign	0.00
R5473:Nsd1	UTSW	13	55247772	missense	probably damaging	1.00
R5498:Nsd1	UTSW	13	55213302	nonsense	probably null
R5503:Nsd1	UTSW	13	55245939	missense	probably damaging	1.00
R5511:Nsd1	UTSW	13	55312730	missense	probably benign	0.00
R5683:Nsd1	UTSW	13	55246148	missense	probably benign	0.00
R5778:Nsd1	UTSW	13	55306979	missense	probably damaging	1.00
R5793:Nsd1	UTSW	13	55248006	missense	probably benign
R5922:Nsd1	UTSW	13	55247475	missense	probably benign	0.01
R5956:Nsd1	UTSW	13	55263404	missense	probably damaging	1.00
R6053:Nsd1	UTSW	13	55293609	missense	probably damaging	1.00
R6141:Nsd1	UTSW	13	55291284	missense	probably damaging	1.00
R6158:Nsd1	UTSW	13	55245621	missense	probably benign
R6224:Nsd1	UTSW	13	55313132	missense	possibly damaging	0.85
R6396:Nsd1	UTSW	13	55238789	missense	probably damaging	1.00
R6598:Nsd1	UTSW	13	55293702	missense	possibly damaging	0.94
R7170:Nsd1	UTSW	13	55261626	nonsense	probably null
R7205:Nsd1	UTSW	13	55246470	missense	probably damaging	1.00
R7215:Nsd1	UTSW	13	55247641	missense	probably benign	0.00
R7432:Nsd1	UTSW	13	55213374	missense	probably benign
R7638:Nsd1	UTSW	13	55312328	missense	probably benign	0.01
R7647:Nsd1	UTSW	13	55299835	missense	probably damaging	0.96
R7658:Nsd1	UTSW	13	55277639	missense	probably damaging	1.00
R7884:Nsd1	UTSW	13	55313255	missense	probably damaging	0.99
R8032:Nsd1	UTSW	13	55310383	missense	probably damaging	1.00
R8113:Nsd1	UTSW	13	55245621	missense	probably benign
R8152:Nsd1	UTSW	13	55310367	missense	possibly damaging	0.49
R8183:Nsd1	UTSW	13	55312373	missense	probably damaging	1.00
R8432:Nsd1	UTSW	13	55247703	missense	possibly damaging	0.91
R8462:Nsd1	UTSW	13	55298376	splice site	probably null
R8469:Nsd1	UTSW	13	55277553	missense	possibly damaging	0.76
R8756:Nsd1	UTSW	13	55313693	missense	probably benign	0.00
R8867:Nsd1	UTSW	13	55282757	missense	probably damaging	1.00
R9035:Nsd1	UTSW	13	55245854	missense	possibly damaging	0.79
R9101:Nsd1	UTSW	13	55313546	missense
R9154:Nsd1	UTSW	13	55213440	missense	probably damaging	1.00
R9155:Nsd1	UTSW	13	55213440	missense	probably damaging	1.00
R9262:Nsd1	UTSW	13	55247058	missense	possibly damaging	0.92
R9592:Nsd1	UTSW	13	55276542	missense	probably damaging	1.00
R9604:Nsd1	UTSW	13	55233994	missense	probably benign	0.25
Z1088:Nsd1	UTSW	13	55213848	missense	possibly damaging	0.83
Z1176:Nsd1	UTSW	13	55245525	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCAGATTGCGATTCCTTATCAGG -3'
(R):5'- TTCAGGCTCCATTGTCTTGG -3'

Sequencing Primer
(F):5'- GCGATTCCTTATCAGGTTTGTC -3'
(R):5'- CAGGCTCCATTGTCTTGGTAGAAC -3'

Posted On

2019-09-13