Incidental Mutation 'R7337:Rmi1'
ID 569604
Institutional Source Beutler Lab
Gene Symbol Rmi1
Ensembl Gene ENSMUSG00000035367
Gene Name RecQ mediated genome instability 1
Synonyms 4932432N11Rik
MMRRC Submission 045427-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.483) question?
Stock # R7337 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 58550062-58558962 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 58557393 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 547 (Y547*)
Ref Sequence ENSEMBL: ENSMUSP00000041035 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042450] [ENSMUST00000224479] [ENSMUST00000225815] [ENSMUST00000225828]
AlphaFold Q9D4G9
Predicted Effect probably null
Transcript: ENSMUST00000042450
AA Change: Y547*
SMART Domains Protein: ENSMUSP00000041035
Gene: ENSMUSG00000035367
AA Change: Y547*

DomainStartEndE-ValueType
DUF1767 11 104 1.62e-34 SMART
low complexity region 243 259 N/A INTRINSIC
low complexity region 271 285 N/A INTRINSIC
Pfam:RMI1_C 479 614 4.2e-45 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000224479
AA Change: Y547*
Predicted Effect probably null
Transcript: ENSMUST00000225815
AA Change: Y547*
Predicted Effect probably null
Transcript: ENSMUST00000225828
AA Change: Y547*
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (88/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] RMI1 is a component of protein complexes that limit DNA crossover formation via the dissolution of double Holliday junctions (Raynard et al., 2006 [PubMed 16595695]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit decreased weight and increased resistance to diet-induced obesity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 A T 2: 69,076,113 (GRCm39) H1198Q probably damaging Het
Adamts14 A G 10: 61,043,239 (GRCm39) V743A probably damaging Het
Adgrg6 A G 10: 14,343,095 (GRCm39) V284A possibly damaging Het
Alb A G 5: 90,622,452 (GRCm39) K560R probably damaging Het
Aqp9 A T 9: 71,069,764 (GRCm39) F8L probably benign Het
Arhgef7 T C 8: 11,835,789 (GRCm39) L182P probably damaging Het
Atr A G 9: 95,753,501 (GRCm39) D701G probably damaging Het
Calr3 C T 8: 73,185,339 (GRCm39) D187N probably damaging Het
Ccdc198 A G 14: 49,471,948 (GRCm39) M163T possibly damaging Het
Ccdc65 A G 15: 98,618,977 (GRCm39) T319A probably benign Het
Ccdc66 A T 14: 27,222,290 (GRCm39) L151H probably damaging Het
Ces2e T A 8: 105,657,688 (GRCm39) probably null Het
Cfap46 A G 7: 139,210,492 (GRCm39) probably null Het
Cfap74 A G 4: 155,544,472 (GRCm39) T1034A unknown Het
Cldnd1 T G 16: 58,549,322 (GRCm39) probably null Het
Clec4f C A 6: 83,630,190 (GRCm39) V123L probably benign Het
Cntn6 C T 6: 104,627,491 (GRCm39) T108I probably damaging Het
Crygn T G 5: 24,961,147 (GRCm39) D53A possibly damaging Het
Cyp27a1 T A 1: 74,774,594 (GRCm39) V204E probably damaging Het
Cyp2c67 A T 19: 39,597,708 (GRCm39) probably null Het
Ddb1 T C 19: 10,605,195 (GRCm39) V1061A possibly damaging Het
Dnah12 G T 14: 26,488,534 (GRCm39) probably null Het
Draxin T C 4: 148,197,216 (GRCm39) T194A probably benign Het
Drosha T A 15: 12,846,285 (GRCm39) D473E possibly damaging Het
Ecpas T C 4: 58,827,047 (GRCm39) T1029A possibly damaging Het
G6pd2 T A 5: 61,967,562 (GRCm39) C446S probably benign Het
Gm29106 C T 1: 118,104,642 (GRCm39) S3L unknown Het
Grin3a T C 4: 49,702,762 (GRCm39) Y908C probably damaging Het
Ints2 G A 11: 86,108,668 (GRCm39) A893V probably benign Het
Ippk C T 13: 49,602,767 (GRCm39) T371I probably benign Het
Irf2 T A 8: 47,260,316 (GRCm39) C83S probably damaging Het
Jph3 C T 8: 122,480,441 (GRCm39) A373V probably benign Het
Kcnj6 C T 16: 94,634,073 (GRCm39) V13I probably benign Het
Lama3 T C 18: 12,640,097 (GRCm39) probably null Het
Lmo7 A T 14: 102,121,640 (GRCm39) Q235L probably damaging Het
Marchf7 A G 2: 60,071,189 (GRCm39) probably null Het
Mfsd6l A T 11: 68,448,109 (GRCm39) Y320F possibly damaging Het
Mroh1 T A 15: 76,335,676 (GRCm39) W1440R probably benign Het
Mrps17 G A 5: 129,793,863 (GRCm39) G19D probably damaging Het
Myt1 A G 2: 181,444,756 (GRCm39) H566R possibly damaging Het
Nav2 T C 7: 49,201,521 (GRCm39) L176P possibly damaging Het
Nop58 T A 1: 59,737,599 (GRCm39) C139S probably benign Het
Nsd1 A G 13: 55,394,022 (GRCm39) D644G probably damaging Het
Nsd2 T A 5: 34,042,816 (GRCm39) C1027S probably damaging Het
Nsmce2 A G 15: 59,473,265 (GRCm39) I235V probably damaging Het
Nyap2 T C 1: 81,314,230 (GRCm39) V642A possibly damaging Het
Or14n1-ps1 A T 7: 86,092,328 (GRCm39) L46F unknown Het
Or8g51 A G 9: 38,609,161 (GRCm39) V167A probably benign Het
Paqr7 A G 4: 134,234,431 (GRCm39) D96G probably benign Het
Parp4 A G 14: 56,839,852 (GRCm39) Y520C probably damaging Het
Pde5a A G 3: 122,542,107 (GRCm39) N199S probably damaging Het
Piezo1 A T 8: 123,212,463 (GRCm39) Y1955N Het
Pnma8a A G 7: 16,695,315 (GRCm39) K390R probably benign Het
Prdm10 G T 9: 31,227,537 (GRCm39) Q47H probably damaging Het
Psg22 T A 7: 18,453,499 (GRCm39) F104I probably benign Het
Ptprf T C 4: 118,068,322 (GRCm39) E1738G probably damaging Het
Rad21l A T 2: 151,500,365 (GRCm39) L218Q probably damaging Het
Rad54l2 A G 9: 106,583,024 (GRCm39) I798T probably damaging Het
Rgs5 G T 1: 169,483,149 (GRCm39) M1I probably null Het
Rhbdl2 T C 4: 123,711,659 (GRCm39) V132A possibly damaging Het
Rptn A T 3: 93,304,212 (GRCm39) D515V probably benign Het
Rsph10b A G 5: 143,898,033 (GRCm39) N505D probably benign Het
Samhd1 T C 2: 156,948,164 (GRCm39) D539G probably damaging Het
Scube3 A T 17: 28,387,156 (GRCm39) I885F probably damaging Het
Sfmbt1 A G 14: 30,506,696 (GRCm39) I247V possibly damaging Het
Slc25a21 T C 12: 56,904,828 (GRCm39) I62V probably benign Het
Slc4a11 T A 2: 130,527,452 (GRCm39) N648Y probably damaging Het
Slc7a11 A G 3: 50,397,448 (GRCm39) V88A possibly damaging Het
Slc7a8 A C 14: 54,964,263 (GRCm39) F397V possibly damaging Het
Sox12 A C 2: 152,239,377 (GRCm39) L81R probably damaging Het
Spg11 T C 2: 121,915,474 (GRCm39) I1057V probably benign Het
St8sia3 G A 18: 64,402,987 (GRCm39) V265I probably benign Het
Stxbp5 A G 10: 9,684,874 (GRCm39) S509P possibly damaging Het
Svep1 T C 4: 58,108,323 (GRCm39) Y1129C probably damaging Het
Tenm4 G T 7: 96,523,333 (GRCm39) R1625L probably benign Het
Tlr4 T C 4: 66,758,191 (GRCm39) F328S possibly damaging Het
Tmprss15 T C 16: 78,868,164 (GRCm39) T215A probably benign Het
Tmprss9 A T 10: 80,718,504 (GRCm39) I62L probably benign Het
Trpm5 C T 7: 142,642,756 (GRCm39) A64T probably benign Het
Txk A C 5: 72,889,109 (GRCm39) Y148* probably null Het
Uba5 C T 9: 103,932,454 (GRCm39) G170R possibly damaging Het
Uggt2 A T 14: 119,323,587 (GRCm39) D231E probably benign Het
Ulk4 A T 9: 121,077,993 (GRCm39) D525E probably benign Het
Vmn1r158 T A 7: 22,489,649 (GRCm39) T187S probably benign Het
Vmn1r52 T A 6: 90,156,605 (GRCm39) M303K probably benign Het
Vmn2r54 A G 7: 12,356,044 (GRCm39) F454S probably benign Het
Zbp1 A T 2: 173,060,546 (GRCm39) L8* probably null Het
Zmym2 A T 14: 57,181,557 (GRCm39) D924V probably benign Het
Other mutations in Rmi1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01090:Rmi1 APN 13 58,557,208 (GRCm39) missense probably damaging 1.00
IGL02304:Rmi1 APN 13 58,557,290 (GRCm39) nonsense probably null
R2046:Rmi1 UTSW 13 58,555,772 (GRCm39) missense probably benign
R2144:Rmi1 UTSW 13 58,555,797 (GRCm39) missense probably damaging 0.99
R4624:Rmi1 UTSW 13 58,556,950 (GRCm39) missense probably benign 0.03
R4625:Rmi1 UTSW 13 58,556,950 (GRCm39) missense probably benign 0.03
R4626:Rmi1 UTSW 13 58,556,950 (GRCm39) missense probably benign 0.03
R4627:Rmi1 UTSW 13 58,556,950 (GRCm39) missense probably benign 0.03
R4628:Rmi1 UTSW 13 58,556,950 (GRCm39) missense probably benign 0.03
R4629:Rmi1 UTSW 13 58,556,950 (GRCm39) missense probably benign 0.03
R5288:Rmi1 UTSW 13 58,557,280 (GRCm39) missense probably damaging 1.00
R6939:Rmi1 UTSW 13 58,557,169 (GRCm39) missense probably benign
R7741:Rmi1 UTSW 13 58,557,067 (GRCm39) missense probably benign
R8871:Rmi1 UTSW 13 58,557,156 (GRCm39) missense probably benign 0.04
R9248:Rmi1 UTSW 13 58,556,899 (GRCm39) missense probably benign 0.04
R9268:Rmi1 UTSW 13 58,555,853 (GRCm39) missense probably damaging 0.99
R9269:Rmi1 UTSW 13 58,556,840 (GRCm39) missense probably benign 0.12
R9627:Rmi1 UTSW 13 58,557,366 (GRCm39) missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- TGGCATGGACTTACATTCTCC -3'
(R):5'- GTGTTCCATACCAACATCTTGC -3'

Sequencing Primer
(F):5'- GTCTGTTCTAATGGCCAGAAAGC -3'
(R):5'- GTTCCATACCAACATCTTGCAATTC -3'
Posted On 2019-09-13