Incidental Mutation 'R7337:Drosha'
ID569613
Institutional Source Beutler Lab
Gene Symbol Drosha
Ensembl Gene ENSMUSG00000022191
Gene Namedrosha, ribonuclease type III
Synonyms1110013A17Rik, Rnasen, Etohi2
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.963) question?
Stock #R7337 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location12824815-12935291 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 12846199 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 473 (D473E)
Ref Sequence ENSEMBL: ENSMUSP00000087762 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090292] [ENSMUST00000169061]
Predicted Effect possibly damaging
Transcript: ENSMUST00000090292
AA Change: D473E

PolyPhen 2 Score 0.804 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000087762
Gene: ENSMUSG00000022191
AA Change: D473E

DomainStartEndE-ValueType
low complexity region 13 32 N/A INTRINSIC
low complexity region 43 69 N/A INTRINSIC
low complexity region 72 102 N/A INTRINSIC
low complexity region 109 137 N/A INTRINSIC
low complexity region 142 169 N/A INTRINSIC
low complexity region 185 200 N/A INTRINSIC
low complexity region 227 269 N/A INTRINSIC
low complexity region 273 301 N/A INTRINSIC
low complexity region 357 370 N/A INTRINSIC
low complexity region 387 410 N/A INTRINSIC
low complexity region 472 499 N/A INTRINSIC
SCOP:d1jfza_ 878 902 4e-4 SMART
RIBOc 942 1076 1.73e-45 SMART
Blast:RIBOc 1086 1112 1e-6 BLAST
RIBOc 1121 1253 1.6e-49 SMART
DSRM 1260 1332 5.75e-20 SMART
coiled coil region 1346 1370 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000169061
AA Change: D473E

PolyPhen 2 Score 0.804 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000129279
Gene: ENSMUSG00000022191
AA Change: D473E

DomainStartEndE-ValueType
low complexity region 13 32 N/A INTRINSIC
low complexity region 43 69 N/A INTRINSIC
low complexity region 72 102 N/A INTRINSIC
low complexity region 109 137 N/A INTRINSIC
low complexity region 142 169 N/A INTRINSIC
low complexity region 185 200 N/A INTRINSIC
low complexity region 227 269 N/A INTRINSIC
low complexity region 273 301 N/A INTRINSIC
low complexity region 357 370 N/A INTRINSIC
low complexity region 387 410 N/A INTRINSIC
low complexity region 472 499 N/A INTRINSIC
SCOP:d1jfza_ 878 902 4e-4 SMART
RIBOc 942 1076 1.73e-45 SMART
Blast:RIBOc 1086 1112 1e-6 BLAST
RIBOc 1121 1253 1.6e-49 SMART
DSRM 1260 1332 5.75e-20 SMART
coiled coil region 1346 1370 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (88/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ribonuclease (RNase) III double-stranded RNA-specific ribonuclease and subunit of the microprocessor protein complex, which catalyzes the initial processing step of microRNA (miRNA) synthesis. The encoded protein cleaves the stem loop structure from the primary microRNA (pri-miRNA) in the nucleus, yielding the precursor miRNA (pre-miRNA), which is then exported to the cytoplasm for further processing. In a human cell line lacking a functional copy of this gene, canonical miRNA synthesis is reduced. Somatic mutations in this gene have been observed in human patients with kidney cancer. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice heterozygous for a knock-out allele and a conditional allele activated in the immune system exhibit increased inflammation in multiple systems, cachexia and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011H14Rik A G 14: 49,234,491 M163T possibly damaging Het
Abcb11 A T 2: 69,245,769 H1198Q probably damaging Het
Adamts14 A G 10: 61,207,460 V743A probably damaging Het
Adgrg6 A G 10: 14,467,351 V284A possibly damaging Het
AI314180 T C 4: 58,827,047 T1029A possibly damaging Het
Alb A G 5: 90,474,593 K560R probably damaging Het
Aqp9 A T 9: 71,162,482 F8L probably benign Het
Arhgef7 T C 8: 11,785,789 L182P probably damaging Het
Atr A G 9: 95,871,448 D701G probably damaging Het
Calr3 C T 8: 72,431,495 D187N probably damaging Het
Ccdc65 A G 15: 98,721,096 T319A probably benign Het
Ccdc66 A T 14: 27,500,333 L151H probably damaging Het
Ces2e T A 8: 104,931,056 probably null Het
Cfap46 A G 7: 139,630,576 probably null Het
Cfap74 A G 4: 155,460,015 T1034A unknown Het
Cldnd1 T G 16: 58,728,959 probably null Het
Clec4f C A 6: 83,653,208 V123L probably benign Het
Cntn6 C T 6: 104,650,530 T108I probably damaging Het
Crygn T G 5: 24,756,149 D53A possibly damaging Het
Cyp27a1 T A 1: 74,735,435 V204E probably damaging Het
Cyp2c67 A T 19: 39,609,264 probably null Het
Ddb1 T C 19: 10,627,831 V1061A possibly damaging Het
Dnah12 G T 14: 26,766,577 probably null Het
Draxin T C 4: 148,112,759 T194A probably benign Het
G6pd2 T A 5: 61,810,219 C446S probably benign Het
Gm29106 C T 1: 118,176,912 S3L unknown Het
Grin3a T C 4: 49,702,762 Y908C probably damaging Het
Ints2 G A 11: 86,217,842 A893V probably benign Het
Ippk C T 13: 49,449,291 T371I probably benign Het
Irf2 T A 8: 46,807,281 C83S probably damaging Het
Jph3 C T 8: 121,753,702 A373V probably benign Het
Kcnj6 C T 16: 94,833,214 V13I probably benign Het
Lama3 T C 18: 12,507,040 probably null Het
Lmo7 A T 14: 101,884,204 Q235L probably damaging Het
March7 A G 2: 60,240,845 probably null Het
Mfsd6l A T 11: 68,557,283 Y320F possibly damaging Het
Mroh1 T A 15: 76,451,476 W1440R probably benign Het
Mrps17 G A 5: 129,716,799 G19D probably damaging Het
Myt1 A G 2: 181,802,963 H566R possibly damaging Het
Nav2 T C 7: 49,551,773 L176P possibly damaging Het
Nop58 T A 1: 59,698,440 C139S probably benign Het
Nsd1 A G 13: 55,246,209 D644G probably damaging Het
Nsd2 T A 5: 33,885,472 C1027S probably damaging Het
Nsmce2 A G 15: 59,601,416 I235V probably damaging Het
Nyap2 T C 1: 81,336,515 V642A possibly damaging Het
Olfr300-ps1 A T 7: 86,443,120 L46F unknown Het
Olfr919 A G 9: 38,697,865 V167A probably benign Het
Paqr7 A G 4: 134,507,120 D96G probably benign Het
Parp4 A G 14: 56,602,395 Y520C probably damaging Het
Pde5a A G 3: 122,748,458 N199S probably damaging Het
Piezo1 A T 8: 122,485,724 Y1955N Het
Pnmal1 A G 7: 16,961,390 K390R probably benign Het
Prdm10 G T 9: 31,316,241 Q47H probably damaging Het
Psg22 T A 7: 18,719,574 F104I probably benign Het
Ptprf T C 4: 118,211,125 E1738G probably damaging Het
Rad21l A T 2: 151,658,445 L218Q probably damaging Het
Rad54l2 A G 9: 106,705,825 I798T probably damaging Het
Rgs5 G T 1: 169,655,580 M1I probably null Het
Rhbdl2 T C 4: 123,817,866 V132A possibly damaging Het
Rmi1 T A 13: 58,409,579 Y547* probably null Het
Rptn A T 3: 93,396,905 D515V probably benign Het
Rsph10b A G 5: 143,961,215 N505D probably benign Het
Samhd1 T C 2: 157,106,244 D539G probably damaging Het
Scube3 A T 17: 28,168,182 I885F probably damaging Het
Sfmbt1 A G 14: 30,784,739 I247V possibly damaging Het
Slc25a21 T C 12: 56,858,043 I62V probably benign Het
Slc4a11 T A 2: 130,685,532 N648Y probably damaging Het
Slc7a11 A G 3: 50,442,999 V88A possibly damaging Het
Slc7a8 A C 14: 54,726,806 F397V possibly damaging Het
Sox12 A C 2: 152,397,457 L81R probably damaging Het
Spg11 T C 2: 122,084,993 I1057V probably benign Het
St8sia3 G A 18: 64,269,916 V265I probably benign Het
Stxbp5 A G 10: 9,809,130 S509P possibly damaging Het
Svep1 T C 4: 58,108,323 Y1129C probably damaging Het
Tenm4 G T 7: 96,874,126 R1625L probably benign Het
Tlr4 T C 4: 66,839,954 F328S possibly damaging Het
Tmprss15 T C 16: 79,071,276 T215A probably benign Het
Tmprss9 A T 10: 80,882,670 I62L probably benign Het
Trpm5 C T 7: 143,089,019 A64T probably benign Het
Txk A C 5: 72,731,766 Y148* probably null Het
Uba5 C T 9: 104,055,255 G170R possibly damaging Het
Uggt2 A T 14: 119,086,175 D231E probably benign Het
Ulk4 A T 9: 121,248,927 D525E probably benign Het
Vmn1r158 T A 7: 22,790,224 T187S probably benign Het
Vmn1r52 T A 6: 90,179,623 M303K probably benign Het
Vmn2r54 A G 7: 12,622,117 F454S probably benign Het
Zbp1 A T 2: 173,218,753 L8* probably null Het
Zmym2 A T 14: 56,944,100 D924V probably benign Het
Other mutations in Drosha
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00576:Drosha APN 15 12883194 missense probably damaging 0.99
IGL00736:Drosha APN 15 12833959 missense unknown
IGL00963:Drosha APN 15 12925997 missense probably damaging 0.99
IGL01010:Drosha APN 15 12827289 unclassified probably benign
IGL01340:Drosha APN 15 12834023 intron probably benign
IGL01481:Drosha APN 15 12842439 missense probably benign
IGL01714:Drosha APN 15 12878784 missense probably damaging 1.00
IGL01721:Drosha APN 15 12846112 nonsense probably null
IGL01765:Drosha APN 15 12902680 missense probably damaging 1.00
IGL01893:Drosha APN 15 12866650 splice site probably benign
IGL01944:Drosha APN 15 12889719 missense probably damaging 1.00
IGL02285:Drosha APN 15 12833864 missense unknown
IGL02970:Drosha APN 15 12913956 missense probably damaging 0.98
IGL02990:Drosha APN 15 12827267 unclassified probably benign
IGL03019:Drosha APN 15 12846099 missense probably damaging 1.00
IGL03279:Drosha APN 15 12859392 missense probably benign 0.03
IGL03390:Drosha APN 15 12884983 splice site probably null
tippicanoe UTSW 15 12859465 splice site probably null
Tyler UTSW 15 12861706 missense probably benign 0.45
R0115:Drosha UTSW 15 12846130 missense probably benign 0.15
R0352:Drosha UTSW 15 12837288 missense unknown
R0401:Drosha UTSW 15 12926031 nonsense probably null
R0541:Drosha UTSW 15 12907388 missense probably benign 0.09
R0784:Drosha UTSW 15 12867678 splice site probably benign
R0918:Drosha UTSW 15 12842533 critical splice donor site probably null
R1473:Drosha UTSW 15 12912520 missense probably benign 0.04
R1503:Drosha UTSW 15 12848073 missense probably benign 0.02
R1526:Drosha UTSW 15 12913984 missense probably damaging 1.00
R1809:Drosha UTSW 15 12890112 missense probably null 1.00
R1859:Drosha UTSW 15 12878718 missense probably benign 0.14
R2004:Drosha UTSW 15 12915381 missense probably damaging 0.98
R2060:Drosha UTSW 15 12924159 missense possibly damaging 0.94
R2516:Drosha UTSW 15 12859465 splice site probably null
R3691:Drosha UTSW 15 12834638 missense unknown
R3784:Drosha UTSW 15 12890529 missense possibly damaging 0.82
R3789:Drosha UTSW 15 12912537 nonsense probably null
R3790:Drosha UTSW 15 12912537 nonsense probably null
R4020:Drosha UTSW 15 12837336 missense possibly damaging 0.96
R4817:Drosha UTSW 15 12914047 missense probably damaging 0.97
R4989:Drosha UTSW 15 12935007 missense probably benign 0.05
R5080:Drosha UTSW 15 12842143 missense probably benign 0.01
R5132:Drosha UTSW 15 12837291 missense unknown
R5215:Drosha UTSW 15 12885133 intron probably benign
R5386:Drosha UTSW 15 12842121 missense probably benign
R5457:Drosha UTSW 15 12926029 missense probably benign 0.26
R5536:Drosha UTSW 15 12929711 missense possibly damaging 0.58
R5800:Drosha UTSW 15 12865067 missense probably damaging 1.00
R5800:Drosha UTSW 15 12902647 missense probably damaging 1.00
R5915:Drosha UTSW 15 12935066 missense probably damaging 0.97
R5988:Drosha UTSW 15 12834496 intron probably benign
R6033:Drosha UTSW 15 12925999 missense probably benign 0.25
R6033:Drosha UTSW 15 12925999 missense probably benign 0.25
R6063:Drosha UTSW 15 12834070 intron probably benign
R6391:Drosha UTSW 15 12889717 nonsense probably null
R6492:Drosha UTSW 15 12861706 missense probably benign 0.45
R6799:Drosha UTSW 15 12912537 nonsense probably null
R6870:Drosha UTSW 15 12907393 missense probably benign 0.17
R6920:Drosha UTSW 15 12834310 missense unknown
R7101:Drosha UTSW 15 12865067 missense probably damaging 1.00
R7142:Drosha UTSW 15 12924146 missense possibly damaging 0.70
R7275:Drosha UTSW 15 12846083 missense possibly damaging 0.73
R7471:Drosha UTSW 15 12889656 missense probably damaging 1.00
R7538:Drosha UTSW 15 12926243 missense probably damaging 1.00
R7559:Drosha UTSW 15 12842422 missense probably damaging 0.96
R7653:Drosha UTSW 15 12859436 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- CGTGAATATGGCTTCTCACCC -3'
(R):5'- CCCTGCTTTTAGAGGGATGC -3'

Sequencing Primer
(F):5'- GTGAATATGGCTTCTCACCCTGATC -3'
(R):5'- GATTCTGAGGCTAGACAACTCTGC -3'
Posted On2019-09-13