Incidental Mutation 'R7337:Drosha'
ID 569613
Institutional Source Beutler Lab
Gene Symbol Drosha
Ensembl Gene ENSMUSG00000022191
Gene Name drosha, ribonuclease type III
Synonyms Etohi2, 1110013A17Rik, Rnasen
MMRRC Submission 045427-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.962) question?
Stock # R7337 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 12824901-12935377 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 12846285 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 473 (D473E)
Ref Sequence ENSEMBL: ENSMUSP00000087762 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090292] [ENSMUST00000169061]
AlphaFold Q5HZJ0
Predicted Effect possibly damaging
Transcript: ENSMUST00000090292
AA Change: D473E

PolyPhen 2 Score 0.804 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000087762
Gene: ENSMUSG00000022191
AA Change: D473E

DomainStartEndE-ValueType
low complexity region 13 32 N/A INTRINSIC
low complexity region 43 69 N/A INTRINSIC
low complexity region 72 102 N/A INTRINSIC
low complexity region 109 137 N/A INTRINSIC
low complexity region 142 169 N/A INTRINSIC
low complexity region 185 200 N/A INTRINSIC
low complexity region 227 269 N/A INTRINSIC
low complexity region 273 301 N/A INTRINSIC
low complexity region 357 370 N/A INTRINSIC
low complexity region 387 410 N/A INTRINSIC
low complexity region 472 499 N/A INTRINSIC
SCOP:d1jfza_ 878 902 4e-4 SMART
RIBOc 942 1076 1.73e-45 SMART
Blast:RIBOc 1086 1112 1e-6 BLAST
RIBOc 1121 1253 1.6e-49 SMART
DSRM 1260 1332 5.75e-20 SMART
coiled coil region 1346 1370 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000169061
AA Change: D473E

PolyPhen 2 Score 0.804 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000129279
Gene: ENSMUSG00000022191
AA Change: D473E

DomainStartEndE-ValueType
low complexity region 13 32 N/A INTRINSIC
low complexity region 43 69 N/A INTRINSIC
low complexity region 72 102 N/A INTRINSIC
low complexity region 109 137 N/A INTRINSIC
low complexity region 142 169 N/A INTRINSIC
low complexity region 185 200 N/A INTRINSIC
low complexity region 227 269 N/A INTRINSIC
low complexity region 273 301 N/A INTRINSIC
low complexity region 357 370 N/A INTRINSIC
low complexity region 387 410 N/A INTRINSIC
low complexity region 472 499 N/A INTRINSIC
SCOP:d1jfza_ 878 902 4e-4 SMART
RIBOc 942 1076 1.73e-45 SMART
Blast:RIBOc 1086 1112 1e-6 BLAST
RIBOc 1121 1253 1.6e-49 SMART
DSRM 1260 1332 5.75e-20 SMART
coiled coil region 1346 1370 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (88/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ribonuclease (RNase) III double-stranded RNA-specific ribonuclease and subunit of the microprocessor protein complex, which catalyzes the initial processing step of microRNA (miRNA) synthesis. The encoded protein cleaves the stem loop structure from the primary microRNA (pri-miRNA) in the nucleus, yielding the precursor miRNA (pre-miRNA), which is then exported to the cytoplasm for further processing. In a human cell line lacking a functional copy of this gene, canonical miRNA synthesis is reduced. Somatic mutations in this gene have been observed in human patients with kidney cancer. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice heterozygous for a knock-out allele and a conditional allele activated in the immune system exhibit increased inflammation in multiple systems, cachexia and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 A T 2: 69,076,113 (GRCm39) H1198Q probably damaging Het
Adamts14 A G 10: 61,043,239 (GRCm39) V743A probably damaging Het
Adgrg6 A G 10: 14,343,095 (GRCm39) V284A possibly damaging Het
Alb A G 5: 90,622,452 (GRCm39) K560R probably damaging Het
Aqp9 A T 9: 71,069,764 (GRCm39) F8L probably benign Het
Arhgef7 T C 8: 11,835,789 (GRCm39) L182P probably damaging Het
Atr A G 9: 95,753,501 (GRCm39) D701G probably damaging Het
Calr3 C T 8: 73,185,339 (GRCm39) D187N probably damaging Het
Ccdc198 A G 14: 49,471,948 (GRCm39) M163T possibly damaging Het
Ccdc65 A G 15: 98,618,977 (GRCm39) T319A probably benign Het
Ccdc66 A T 14: 27,222,290 (GRCm39) L151H probably damaging Het
Ces2e T A 8: 105,657,688 (GRCm39) probably null Het
Cfap46 A G 7: 139,210,492 (GRCm39) probably null Het
Cfap74 A G 4: 155,544,472 (GRCm39) T1034A unknown Het
Cldnd1 T G 16: 58,549,322 (GRCm39) probably null Het
Clec4f C A 6: 83,630,190 (GRCm39) V123L probably benign Het
Cntn6 C T 6: 104,627,491 (GRCm39) T108I probably damaging Het
Crygn T G 5: 24,961,147 (GRCm39) D53A possibly damaging Het
Cyp27a1 T A 1: 74,774,594 (GRCm39) V204E probably damaging Het
Cyp2c67 A T 19: 39,597,708 (GRCm39) probably null Het
Ddb1 T C 19: 10,605,195 (GRCm39) V1061A possibly damaging Het
Dnah12 G T 14: 26,488,534 (GRCm39) probably null Het
Draxin T C 4: 148,197,216 (GRCm39) T194A probably benign Het
Ecpas T C 4: 58,827,047 (GRCm39) T1029A possibly damaging Het
G6pd2 T A 5: 61,967,562 (GRCm39) C446S probably benign Het
Gm29106 C T 1: 118,104,642 (GRCm39) S3L unknown Het
Grin3a T C 4: 49,702,762 (GRCm39) Y908C probably damaging Het
Ints2 G A 11: 86,108,668 (GRCm39) A893V probably benign Het
Ippk C T 13: 49,602,767 (GRCm39) T371I probably benign Het
Irf2 T A 8: 47,260,316 (GRCm39) C83S probably damaging Het
Jph3 C T 8: 122,480,441 (GRCm39) A373V probably benign Het
Kcnj6 C T 16: 94,634,073 (GRCm39) V13I probably benign Het
Lama3 T C 18: 12,640,097 (GRCm39) probably null Het
Lmo7 A T 14: 102,121,640 (GRCm39) Q235L probably damaging Het
Marchf7 A G 2: 60,071,189 (GRCm39) probably null Het
Mfsd6l A T 11: 68,448,109 (GRCm39) Y320F possibly damaging Het
Mroh1 T A 15: 76,335,676 (GRCm39) W1440R probably benign Het
Mrps17 G A 5: 129,793,863 (GRCm39) G19D probably damaging Het
Myt1 A G 2: 181,444,756 (GRCm39) H566R possibly damaging Het
Nav2 T C 7: 49,201,521 (GRCm39) L176P possibly damaging Het
Nop58 T A 1: 59,737,599 (GRCm39) C139S probably benign Het
Nsd1 A G 13: 55,394,022 (GRCm39) D644G probably damaging Het
Nsd2 T A 5: 34,042,816 (GRCm39) C1027S probably damaging Het
Nsmce2 A G 15: 59,473,265 (GRCm39) I235V probably damaging Het
Nyap2 T C 1: 81,314,230 (GRCm39) V642A possibly damaging Het
Or14n1-ps1 A T 7: 86,092,328 (GRCm39) L46F unknown Het
Or8g51 A G 9: 38,609,161 (GRCm39) V167A probably benign Het
Paqr7 A G 4: 134,234,431 (GRCm39) D96G probably benign Het
Parp4 A G 14: 56,839,852 (GRCm39) Y520C probably damaging Het
Pde5a A G 3: 122,542,107 (GRCm39) N199S probably damaging Het
Piezo1 A T 8: 123,212,463 (GRCm39) Y1955N Het
Pnma8a A G 7: 16,695,315 (GRCm39) K390R probably benign Het
Prdm10 G T 9: 31,227,537 (GRCm39) Q47H probably damaging Het
Psg22 T A 7: 18,453,499 (GRCm39) F104I probably benign Het
Ptprf T C 4: 118,068,322 (GRCm39) E1738G probably damaging Het
Rad21l A T 2: 151,500,365 (GRCm39) L218Q probably damaging Het
Rad54l2 A G 9: 106,583,024 (GRCm39) I798T probably damaging Het
Rgs5 G T 1: 169,483,149 (GRCm39) M1I probably null Het
Rhbdl2 T C 4: 123,711,659 (GRCm39) V132A possibly damaging Het
Rmi1 T A 13: 58,557,393 (GRCm39) Y547* probably null Het
Rptn A T 3: 93,304,212 (GRCm39) D515V probably benign Het
Rsph10b A G 5: 143,898,033 (GRCm39) N505D probably benign Het
Samhd1 T C 2: 156,948,164 (GRCm39) D539G probably damaging Het
Scube3 A T 17: 28,387,156 (GRCm39) I885F probably damaging Het
Sfmbt1 A G 14: 30,506,696 (GRCm39) I247V possibly damaging Het
Slc25a21 T C 12: 56,904,828 (GRCm39) I62V probably benign Het
Slc4a11 T A 2: 130,527,452 (GRCm39) N648Y probably damaging Het
Slc7a11 A G 3: 50,397,448 (GRCm39) V88A possibly damaging Het
Slc7a8 A C 14: 54,964,263 (GRCm39) F397V possibly damaging Het
Sox12 A C 2: 152,239,377 (GRCm39) L81R probably damaging Het
Spg11 T C 2: 121,915,474 (GRCm39) I1057V probably benign Het
St8sia3 G A 18: 64,402,987 (GRCm39) V265I probably benign Het
Stxbp5 A G 10: 9,684,874 (GRCm39) S509P possibly damaging Het
Svep1 T C 4: 58,108,323 (GRCm39) Y1129C probably damaging Het
Tenm4 G T 7: 96,523,333 (GRCm39) R1625L probably benign Het
Tlr4 T C 4: 66,758,191 (GRCm39) F328S possibly damaging Het
Tmprss15 T C 16: 78,868,164 (GRCm39) T215A probably benign Het
Tmprss9 A T 10: 80,718,504 (GRCm39) I62L probably benign Het
Trpm5 C T 7: 142,642,756 (GRCm39) A64T probably benign Het
Txk A C 5: 72,889,109 (GRCm39) Y148* probably null Het
Uba5 C T 9: 103,932,454 (GRCm39) G170R possibly damaging Het
Uggt2 A T 14: 119,323,587 (GRCm39) D231E probably benign Het
Ulk4 A T 9: 121,077,993 (GRCm39) D525E probably benign Het
Vmn1r158 T A 7: 22,489,649 (GRCm39) T187S probably benign Het
Vmn1r52 T A 6: 90,156,605 (GRCm39) M303K probably benign Het
Vmn2r54 A G 7: 12,356,044 (GRCm39) F454S probably benign Het
Zbp1 A T 2: 173,060,546 (GRCm39) L8* probably null Het
Zmym2 A T 14: 57,181,557 (GRCm39) D924V probably benign Het
Other mutations in Drosha
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00576:Drosha APN 15 12,883,280 (GRCm39) missense probably damaging 0.99
IGL00736:Drosha APN 15 12,834,045 (GRCm39) missense unknown
IGL00963:Drosha APN 15 12,926,083 (GRCm39) missense probably damaging 0.99
IGL01010:Drosha APN 15 12,827,375 (GRCm39) unclassified probably benign
IGL01340:Drosha APN 15 12,834,109 (GRCm39) intron probably benign
IGL01481:Drosha APN 15 12,842,525 (GRCm39) missense probably benign
IGL01714:Drosha APN 15 12,878,870 (GRCm39) missense probably damaging 1.00
IGL01721:Drosha APN 15 12,846,198 (GRCm39) nonsense probably null
IGL01765:Drosha APN 15 12,902,766 (GRCm39) missense probably damaging 1.00
IGL01893:Drosha APN 15 12,866,736 (GRCm39) splice site probably benign
IGL01944:Drosha APN 15 12,889,805 (GRCm39) missense probably damaging 1.00
IGL02285:Drosha APN 15 12,833,950 (GRCm39) missense unknown
IGL02970:Drosha APN 15 12,914,042 (GRCm39) missense probably damaging 0.98
IGL02990:Drosha APN 15 12,827,353 (GRCm39) unclassified probably benign
IGL03019:Drosha APN 15 12,846,185 (GRCm39) missense probably damaging 1.00
IGL03279:Drosha APN 15 12,859,478 (GRCm39) missense probably benign 0.03
IGL03390:Drosha APN 15 12,885,069 (GRCm39) splice site probably null
tippicanoe UTSW 15 12,859,551 (GRCm39) splice site probably null
Tyler UTSW 15 12,861,792 (GRCm39) missense probably benign 0.45
R0115:Drosha UTSW 15 12,846,216 (GRCm39) missense probably benign 0.15
R0352:Drosha UTSW 15 12,837,374 (GRCm39) missense unknown
R0401:Drosha UTSW 15 12,926,117 (GRCm39) nonsense probably null
R0541:Drosha UTSW 15 12,907,474 (GRCm39) missense probably benign 0.09
R0784:Drosha UTSW 15 12,867,764 (GRCm39) splice site probably benign
R0918:Drosha UTSW 15 12,842,619 (GRCm39) critical splice donor site probably null
R1473:Drosha UTSW 15 12,912,606 (GRCm39) missense probably benign 0.04
R1503:Drosha UTSW 15 12,848,159 (GRCm39) missense probably benign 0.02
R1526:Drosha UTSW 15 12,914,070 (GRCm39) missense probably damaging 1.00
R1809:Drosha UTSW 15 12,890,198 (GRCm39) missense probably null 1.00
R1859:Drosha UTSW 15 12,878,804 (GRCm39) missense probably benign 0.14
R2004:Drosha UTSW 15 12,915,467 (GRCm39) missense probably damaging 0.98
R2060:Drosha UTSW 15 12,924,245 (GRCm39) missense possibly damaging 0.94
R2516:Drosha UTSW 15 12,859,551 (GRCm39) splice site probably null
R3691:Drosha UTSW 15 12,834,724 (GRCm39) missense unknown
R3784:Drosha UTSW 15 12,890,615 (GRCm39) missense possibly damaging 0.82
R3789:Drosha UTSW 15 12,912,623 (GRCm39) nonsense probably null
R3790:Drosha UTSW 15 12,912,623 (GRCm39) nonsense probably null
R4020:Drosha UTSW 15 12,837,422 (GRCm39) missense possibly damaging 0.96
R4817:Drosha UTSW 15 12,914,133 (GRCm39) missense probably damaging 0.97
R4989:Drosha UTSW 15 12,935,093 (GRCm39) missense probably benign 0.05
R5080:Drosha UTSW 15 12,842,229 (GRCm39) missense probably benign 0.01
R5132:Drosha UTSW 15 12,837,377 (GRCm39) missense unknown
R5215:Drosha UTSW 15 12,885,219 (GRCm39) intron probably benign
R5386:Drosha UTSW 15 12,842,207 (GRCm39) missense probably benign
R5457:Drosha UTSW 15 12,926,115 (GRCm39) missense probably benign 0.26
R5536:Drosha UTSW 15 12,929,797 (GRCm39) missense possibly damaging 0.58
R5800:Drosha UTSW 15 12,902,733 (GRCm39) missense probably damaging 1.00
R5800:Drosha UTSW 15 12,865,153 (GRCm39) missense probably damaging 1.00
R5915:Drosha UTSW 15 12,935,152 (GRCm39) missense probably damaging 0.97
R5988:Drosha UTSW 15 12,834,582 (GRCm39) intron probably benign
R6033:Drosha UTSW 15 12,926,085 (GRCm39) missense probably benign 0.25
R6033:Drosha UTSW 15 12,926,085 (GRCm39) missense probably benign 0.25
R6063:Drosha UTSW 15 12,834,156 (GRCm39) intron probably benign
R6391:Drosha UTSW 15 12,889,803 (GRCm39) nonsense probably null
R6492:Drosha UTSW 15 12,861,792 (GRCm39) missense probably benign 0.45
R6799:Drosha UTSW 15 12,912,623 (GRCm39) nonsense probably null
R6870:Drosha UTSW 15 12,907,479 (GRCm39) missense probably benign 0.17
R6920:Drosha UTSW 15 12,834,396 (GRCm39) missense unknown
R7101:Drosha UTSW 15 12,865,153 (GRCm39) missense probably damaging 1.00
R7142:Drosha UTSW 15 12,924,232 (GRCm39) missense possibly damaging 0.70
R7275:Drosha UTSW 15 12,846,169 (GRCm39) missense possibly damaging 0.73
R7471:Drosha UTSW 15 12,889,742 (GRCm39) missense probably damaging 1.00
R7538:Drosha UTSW 15 12,926,329 (GRCm39) missense probably damaging 1.00
R7559:Drosha UTSW 15 12,842,508 (GRCm39) missense probably damaging 0.96
R7651:Drosha UTSW 15 12,859,522 (GRCm39) missense probably benign 0.30
R7652:Drosha UTSW 15 12,859,522 (GRCm39) missense probably benign 0.30
R7653:Drosha UTSW 15 12,859,522 (GRCm39) missense probably benign 0.30
R7727:Drosha UTSW 15 12,881,731 (GRCm39) missense probably damaging 1.00
R7780:Drosha UTSW 15 12,848,172 (GRCm39) missense probably benign 0.01
R8068:Drosha UTSW 15 12,883,276 (GRCm39) nonsense probably null
R8283:Drosha UTSW 15 12,890,587 (GRCm39) missense possibly damaging 0.47
R8523:Drosha UTSW 15 12,834,408 (GRCm39) missense unknown
R8985:Drosha UTSW 15 12,924,187 (GRCm39) missense possibly damaging 0.66
R9418:Drosha UTSW 15 12,885,167 (GRCm39) missense probably benign 0.02
R9501:Drosha UTSW 15 12,928,992 (GRCm39) missense probably damaging 1.00
R9674:Drosha UTSW 15 12,890,170 (GRCm39) missense probably damaging 1.00
Z1177:Drosha UTSW 15 12,842,178 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- CGTGAATATGGCTTCTCACCC -3'
(R):5'- CCCTGCTTTTAGAGGGATGC -3'

Sequencing Primer
(F):5'- GTGAATATGGCTTCTCACCCTGATC -3'
(R):5'- GATTCTGAGGCTAGACAACTCTGC -3'
Posted On 2019-09-13