Incidental Mutation 'R7337:Scube3'
ID569619
Institutional Source Beutler Lab
Gene Symbol Scube3
Ensembl Gene ENSMUSG00000038677
Gene Namesignal peptide, CUB domain, EGF-like 3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.444) question?
Stock #R7337 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location28142316-28174852 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 28168182 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 885 (I885F)
Ref Sequence ENSEMBL: ENSMUSP00000038366 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043503]
Predicted Effect probably damaging
Transcript: ENSMUST00000043503
AA Change: I885F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000038366
Gene: ENSMUSG00000038677
AA Change: I885F

DomainStartEndE-ValueType
low complexity region 9 15 N/A INTRINSIC
EGF_CA 29 69 5.23e-9 SMART
EGF_CA 70 111 1.2e-8 SMART
EGF_CA 112 152 1.14e-9 SMART
EGF 160 198 6.65e-2 SMART
EGF 200 237 7.95e0 SMART
EGF 239 276 7.76e-3 SMART
EGF_CA 277 317 7.63e-11 SMART
EGF_CA 318 356 7.01e-10 SMART
EGF_CA 357 398 6.8e-8 SMART
Pfam:GCC2_GCC3 642 689 8.6e-15 PFAM
Pfam:GCC2_GCC3 696 743 4.2e-17 PFAM
Pfam:GCC2_GCC3 752 799 5.8e-17 PFAM
CUB 804 916 1.09e-16 SMART
Blast:CUB 942 988 8e-15 BLAST
Predicted Effect
SMART Domains Protein: ENSMUSP00000117490
Gene: ENSMUSG00000038677
AA Change: I747F

DomainStartEndE-ValueType
EGF_like 1 28 1.2e-1 SMART
EGF_CA 29 69 1.14e-9 SMART
EGF 77 115 6.65e-2 SMART
EGF 117 154 7.95e0 SMART
EGF 156 193 7.76e-3 SMART
EGF_CA 194 234 7.63e-11 SMART
EGF_CA 235 273 7.01e-10 SMART
EGF_CA 274 315 6.8e-8 SMART
Pfam:GCC2_GCC3 559 606 1.8e-17 PFAM
Pfam:GCC2_GCC3 615 662 4.2e-17 PFAM
CUB 667 779 1.09e-16 SMART
Meta Mutation Damage Score 0.4370 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (88/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the signal peptide, complement subcomponents C1r/C1s, Uegf, bone morphogenetic protein-1 and epidermal growth factor-like domain containing protein family. Overexpression of this gene in human embryonic kidney cells results in secretion of a glycosylated form of the protein that forms oligomers and tethers to the cell surface. This gene is upregulated in lung cancer tumor tissue compared to healthy tissue and is associated with loss of the epithelial marker E-cadherin and with increased expression of vimentin, a mesenchymal marker. In addition, the protein encoded by this gene is a transforming growth factor beta receptor ligand, and when secreted by cancer cells, it can be cleaved in vitro to release the N-terminal epidermal growth factor-like repeat domain and the C-terminal complement subcomponents C1r/C1s domain. Both the full length protein and C-terminal fragment can bind to the transforming growth factor beta type II receptor to promote the epithelial-mesenchymal transition and tumor angiogenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice homozygous for a targeted allele encoding a truncated protein exhibit normal morphology. Mice with a point mutation show skeletal abnormalities, bone metabolism alterations, changes in renal function, behavioral alternations and hearing loss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011H14Rik A G 14: 49,234,491 M163T possibly damaging Het
Abcb11 A T 2: 69,245,769 H1198Q probably damaging Het
Adamts14 A G 10: 61,207,460 V743A probably damaging Het
Adgrg6 A G 10: 14,467,351 V284A possibly damaging Het
AI314180 T C 4: 58,827,047 T1029A possibly damaging Het
Alb A G 5: 90,474,593 K560R probably damaging Het
Aqp9 A T 9: 71,162,482 F8L probably benign Het
Arhgef7 T C 8: 11,785,789 L182P probably damaging Het
Atr A G 9: 95,871,448 D701G probably damaging Het
Calr3 C T 8: 72,431,495 D187N probably damaging Het
Ccdc65 A G 15: 98,721,096 T319A probably benign Het
Ccdc66 A T 14: 27,500,333 L151H probably damaging Het
Ces2e T A 8: 104,931,056 probably null Het
Cfap46 A G 7: 139,630,576 probably null Het
Cfap74 A G 4: 155,460,015 T1034A unknown Het
Cldnd1 T G 16: 58,728,959 probably null Het
Clec4f C A 6: 83,653,208 V123L probably benign Het
Cntn6 C T 6: 104,650,530 T108I probably damaging Het
Crygn T G 5: 24,756,149 D53A possibly damaging Het
Cyp27a1 T A 1: 74,735,435 V204E probably damaging Het
Cyp2c67 A T 19: 39,609,264 probably null Het
Ddb1 T C 19: 10,627,831 V1061A possibly damaging Het
Dnah12 G T 14: 26,766,577 probably null Het
Draxin T C 4: 148,112,759 T194A probably benign Het
Drosha T A 15: 12,846,199 D473E possibly damaging Het
G6pd2 T A 5: 61,810,219 C446S probably benign Het
Gm29106 C T 1: 118,176,912 S3L unknown Het
Grin3a T C 4: 49,702,762 Y908C probably damaging Het
Ints2 G A 11: 86,217,842 A893V probably benign Het
Ippk C T 13: 49,449,291 T371I probably benign Het
Irf2 T A 8: 46,807,281 C83S probably damaging Het
Jph3 C T 8: 121,753,702 A373V probably benign Het
Kcnj6 C T 16: 94,833,214 V13I probably benign Het
Lama3 T C 18: 12,507,040 probably null Het
Lmo7 A T 14: 101,884,204 Q235L probably damaging Het
March7 A G 2: 60,240,845 probably null Het
Mfsd6l A T 11: 68,557,283 Y320F possibly damaging Het
Mroh1 T A 15: 76,451,476 W1440R probably benign Het
Mrps17 G A 5: 129,716,799 G19D probably damaging Het
Myt1 A G 2: 181,802,963 H566R possibly damaging Het
Nav2 T C 7: 49,551,773 L176P possibly damaging Het
Nop58 T A 1: 59,698,440 C139S probably benign Het
Nsd1 A G 13: 55,246,209 D644G probably damaging Het
Nsd2 T A 5: 33,885,472 C1027S probably damaging Het
Nsmce2 A G 15: 59,601,416 I235V probably damaging Het
Nyap2 T C 1: 81,336,515 V642A possibly damaging Het
Olfr300-ps1 A T 7: 86,443,120 L46F unknown Het
Olfr919 A G 9: 38,697,865 V167A probably benign Het
Paqr7 A G 4: 134,507,120 D96G probably benign Het
Parp4 A G 14: 56,602,395 Y520C probably damaging Het
Pde5a A G 3: 122,748,458 N199S probably damaging Het
Piezo1 A T 8: 122,485,724 Y1955N Het
Pnmal1 A G 7: 16,961,390 K390R probably benign Het
Prdm10 G T 9: 31,316,241 Q47H probably damaging Het
Psg22 T A 7: 18,719,574 F104I probably benign Het
Ptprf T C 4: 118,211,125 E1738G probably damaging Het
Rad21l A T 2: 151,658,445 L218Q probably damaging Het
Rad54l2 A G 9: 106,705,825 I798T probably damaging Het
Rgs5 G T 1: 169,655,580 M1I probably null Het
Rhbdl2 T C 4: 123,817,866 V132A possibly damaging Het
Rmi1 T A 13: 58,409,579 Y547* probably null Het
Rptn A T 3: 93,396,905 D515V probably benign Het
Rsph10b A G 5: 143,961,215 N505D probably benign Het
Samhd1 T C 2: 157,106,244 D539G probably damaging Het
Sfmbt1 A G 14: 30,784,739 I247V possibly damaging Het
Slc25a21 T C 12: 56,858,043 I62V probably benign Het
Slc4a11 T A 2: 130,685,532 N648Y probably damaging Het
Slc7a11 A G 3: 50,442,999 V88A possibly damaging Het
Slc7a8 A C 14: 54,726,806 F397V possibly damaging Het
Sox12 A C 2: 152,397,457 L81R probably damaging Het
Spg11 T C 2: 122,084,993 I1057V probably benign Het
St8sia3 G A 18: 64,269,916 V265I probably benign Het
Stxbp5 A G 10: 9,809,130 S509P possibly damaging Het
Svep1 T C 4: 58,108,323 Y1129C probably damaging Het
Tenm4 G T 7: 96,874,126 R1625L probably benign Het
Tlr4 T C 4: 66,839,954 F328S possibly damaging Het
Tmprss15 T C 16: 79,071,276 T215A probably benign Het
Tmprss9 A T 10: 80,882,670 I62L probably benign Het
Trpm5 C T 7: 143,089,019 A64T probably benign Het
Txk A C 5: 72,731,766 Y148* probably null Het
Uba5 C T 9: 104,055,255 G170R possibly damaging Het
Uggt2 A T 14: 119,086,175 D231E probably benign Het
Ulk4 A T 9: 121,248,927 D525E probably benign Het
Vmn1r158 T A 7: 22,790,224 T187S probably benign Het
Vmn1r52 T A 6: 90,179,623 M303K probably benign Het
Vmn2r54 A G 7: 12,622,117 F454S probably benign Het
Zbp1 A T 2: 173,218,753 L8* probably null Het
Zmym2 A T 14: 56,944,100 D924V probably benign Het
Other mutations in Scube3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02019:Scube3 APN 17 28167684 missense probably damaging 1.00
IGL02189:Scube3 APN 17 28162996 missense probably benign
IGL02416:Scube3 APN 17 28164136 missense probably damaging 1.00
IGL02904:Scube3 APN 17 28167600 missense probably benign 0.01
IGL03153:Scube3 APN 17 28167058 missense possibly damaging 0.54
IGL03309:Scube3 APN 17 28164357 nonsense probably null
dinklage UTSW 17 28162388 missense probably damaging 1.00
R0027:Scube3 UTSW 17 28164357 nonsense probably null
R0084:Scube3 UTSW 17 28162961 missense probably benign 0.12
R0122:Scube3 UTSW 17 28166528 splice site probably benign
R0544:Scube3 UTSW 17 28164153 missense probably damaging 1.00
R1779:Scube3 UTSW 17 28168379 splice site probably benign
R1842:Scube3 UTSW 17 28165089 missense probably damaging 1.00
R1878:Scube3 UTSW 17 28152413 missense probably benign 0.10
R1950:Scube3 UTSW 17 28164300 missense possibly damaging 0.66
R2011:Scube3 UTSW 17 28168158 missense probably damaging 0.99
R2164:Scube3 UTSW 17 28166134 missense possibly damaging 0.64
R4356:Scube3 UTSW 17 28164309 missense probably benign 0.01
R4392:Scube3 UTSW 17 28164788 missense probably null
R4528:Scube3 UTSW 17 28162999 missense possibly damaging 0.82
R4709:Scube3 UTSW 17 28167192 splice site probably null
R4809:Scube3 UTSW 17 28165173 missense probably damaging 1.00
R4832:Scube3 UTSW 17 28166015 missense probably damaging 0.98
R4841:Scube3 UTSW 17 28164123 missense probably damaging 1.00
R4842:Scube3 UTSW 17 28164123 missense probably damaging 1.00
R5372:Scube3 UTSW 17 28152482 missense probably damaging 0.99
R5889:Scube3 UTSW 17 28160913 missense possibly damaging 0.84
R5936:Scube3 UTSW 17 28165487 missense probably damaging 1.00
R6523:Scube3 UTSW 17 28162388 missense probably damaging 1.00
R7051:Scube3 UTSW 17 28167599 missense probably benign
R7699:Scube3 UTSW 17 28167049 missense probably damaging 1.00
R7700:Scube3 UTSW 17 28167049 missense probably damaging 1.00
R7848:Scube3 UTSW 17 28165595 missense probably benign
R7950:Scube3 UTSW 17 28171226 missense probably benign 0.11
RF009:Scube3 UTSW 17 28168397 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCAGTAGTCGGCCTTGTAG -3'
(R):5'- TCTGTAAAGTCAACAGGGTTGG -3'

Sequencing Primer
(F):5'- TCGGCCTTGTAGAATAAACCTGG -3'
(R):5'- CAACAGGGTTGGGGGCTG -3'
Posted On2019-09-13