Incidental Mutation 'R7338:Gjd2'
ID569628
Institutional Source Beutler Lab
Gene Symbol Gjd2
Ensembl Gene ENSMUSG00000068615
Gene Namegap junction protein, delta 2
Synonymsconnexin36, Cx36, Gja9
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.223) question?
Stock #R7338 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location114009601-114013619 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 114011102 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 298 (R298H)
Ref Sequence ENSEMBL: ENSMUSP00000087742 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090275]
Predicted Effect probably damaging
Transcript: ENSMUST00000090275
AA Change: R298H

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000087742
Gene: ENSMUSG00000068615
AA Change: R298H

DomainStartEndE-ValueType
CNX 44 77 1.01e-15 SMART
low complexity region 125 137 N/A INTRINSIC
Connexin_CCC 209 275 4.72e-39 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the connexin protein family. Connexins are gap junction proteins which are arranged in groups of 6 around a central pore to form a connexon, a component of the gap junction intercellular channel. The channels formed by this protein allow cationic molecule exchange between human beta cells and may function in the regulation of insulin secretion. [provided by RefSeq, Oct 2012]
PHENOTYPE: Nullizygous mutations can cause loss of electrical synapses, impaired synchronous activity of inhibitory networks, altered spike synchrony in OB glomeruli, absent coupling of alpha-ganglion cells in retina, and abnormal cued conditioning, nerve fiber andsingle cell responses, and insulin secretion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T C 17: 24,376,743 S357P possibly damaging Het
Arhgap28 T C 17: 67,896,111 R166G probably damaging Het
Bcan T A 3: 87,994,243 E384V probably damaging Het
Bcl9l A G 9: 44,508,708 N1137S probably benign Het
Caprin1 A G 2: 103,779,423 L170S probably benign Het
Card6 C T 15: 5,099,872 E681K probably benign Het
Catsperb G A 12: 101,480,984 V248I probably benign Het
Ccnj T A 19: 40,837,033 H62Q probably damaging Het
Cd180 A C 13: 102,706,428 I661L probably benign Het
Cdk11b A G 4: 155,647,551 R473G unknown Het
Cep126 T C 9: 8,099,798 T912A possibly damaging Het
Chek2 T A 5: 110,873,514 V530E probably benign Het
Chga G T 12: 102,562,841 S359I probably damaging Het
Cnrip1 T C 11: 17,054,657 V69A probably damaging Het
Cyp2a5 A T 7: 26,842,947 Q458L probably damaging Het
Cyp2j11 T A 4: 96,307,287 T391S possibly damaging Het
Dhx16 T C 17: 35,888,144 L794P probably damaging Het
Dscaml1 A G 9: 45,674,504 T580A probably benign Het
Elmo1 A T 13: 20,280,812 I184L probably benign Het
Gabra1 C T 11: 42,182,294 G51S unknown Het
Gabrr3 C A 16: 59,448,076 L351I possibly damaging Het
Gbp7 A T 3: 142,538,025 N111I probably damaging Het
Gm5930 T C 14: 44,336,457 Y141C probably damaging Het
Grin3a G T 4: 49,771,238 N511K probably benign Het
Hdac7 T C 15: 97,810,022 D122G probably benign Het
Ifi204 G A 1: 173,760,137 T152I possibly damaging Het
Lrrc9 C T 12: 72,463,531 probably null Het
Med21 T A 6: 146,642,584 probably benign Het
Mmp19 A T 10: 128,799,083 T523S probably benign Het
Nav3 G A 10: 109,769,212 T1000I probably benign Het
Nin T C 12: 70,044,064 D859G Het
Nip7 T G 8: 107,057,284 L52R possibly damaging Het
Olfr1039 A T 2: 86,131,382 F94I probably damaging Het
Olfr524 A T 7: 140,202,533 V79E probably benign Het
Olfr934 A G 9: 38,982,520 Y175H probably damaging Het
Otop1 T A 5: 38,300,203 Y435* probably null Het
Pak4 A G 7: 28,564,956 S174P probably benign Het
Pcsk7 G A 9: 45,925,989 R537Q probably benign Het
Podxl G A 6: 31,529,006 S34F unknown Het
Prr36 G A 8: 4,216,212 R113C probably damaging Het
Ptk7 T C 17: 46,579,599 I436V probably benign Het
Slc13a5 C T 11: 72,266,484 V28I probably benign Het
Slc9a3r2 T A 17: 24,650,208 probably benign Het
Slco6d1 A T 1: 98,421,372 D56V probably benign Het
Spg11 G A 2: 122,055,377 R2317W probably damaging Het
Stom T A 2: 35,323,748 probably null Het
Svs5 T C 2: 164,332,808 L8P possibly damaging Het
Tmem141 C A 2: 25,621,614 V39F probably damaging Het
Tmprss6 A G 15: 78,459,819 L181P probably damaging Het
Tnni3 A G 7: 4,521,380 S40P probably benign Het
Tubgcp4 A G 2: 121,193,984 I548V probably benign Het
Twf2 A G 9: 106,203,939 probably benign Het
Wnt5b C A 6: 119,448,131 probably null Het
Wrap73 A G 4: 154,152,586 D210G probably benign Het
Yipf4 T G 17: 74,489,776 S21A probably benign Het
Zscan20 A G 4: 128,588,150 M573T probably benign Het
Other mutations in Gjd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00424:Gjd2 APN 2 114011777 missense probably damaging 1.00
IGL01759:Gjd2 APN 2 114011106 missense probably benign 0.00
IGL02307:Gjd2 APN 2 114011913 missense possibly damaging 0.95
IGL02862:Gjd2 APN 2 114013143 utr 5 prime probably benign
IGL03206:Gjd2 APN 2 114011723 missense probably damaging 1.00
R0212:Gjd2 UTSW 2 114011472 missense probably benign 0.00
R1306:Gjd2 UTSW 2 114011865 missense probably damaging 0.97
R1637:Gjd2 UTSW 2 114011308 nonsense probably null
R1719:Gjd2 UTSW 2 114013133 start codon destroyed probably null 1.00
R2051:Gjd2 UTSW 2 114011058 missense probably damaging 1.00
R4809:Gjd2 UTSW 2 114011541 missense probably damaging 1.00
R5596:Gjd2 UTSW 2 114011484 missense possibly damaging 0.93
R6891:Gjd2 UTSW 2 114013094 missense possibly damaging 0.85
R7461:Gjd2 UTSW 2 114011118 missense possibly damaging 0.94
R7693:Gjd2 UTSW 2 114011828 missense probably damaging 1.00
X0065:Gjd2 UTSW 2 114011637 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GTATCCTAGACCTTCACAGCG -3'
(R):5'- TGTATGAGTGCAACCGTTACCC -3'

Sequencing Primer
(F):5'- CGAGCATCACCCGAATGAGG -3'
(R):5'- GTTACCCCTGCATCAAGGAG -3'
Posted On2019-09-13