Incidental Mutation 'R7338:Olfr524'
ID569646
Institutional Source Beutler Lab
Gene Symbol Olfr524
Ensembl Gene ENSMUSG00000050366
Gene Nameolfactory receptor 524
SynonymsGA_x6K02T2PBJ9-42354580-42353624, MOR103-14P
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R7338 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location140198499-140205964 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 140202533 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 79 (V79E)
Ref Sequence ENSEMBL: ENSMUSP00000150970 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051943] [ENSMUST00000215815]
Predicted Effect probably benign
Transcript: ENSMUST00000051943
AA Change: V79E

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000053565
Gene: ENSMUSG00000050366
AA Change: V79E

DomainStartEndE-ValueType
Pfam:7tm_4 32 309 7.5e-56 PFAM
Pfam:7tm_1 42 292 6.4e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215815
AA Change: V79E

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T C 17: 24,376,743 S357P possibly damaging Het
Arhgap28 T C 17: 67,896,111 R166G probably damaging Het
Bcan T A 3: 87,994,243 E384V probably damaging Het
Bcl9l A G 9: 44,508,708 N1137S probably benign Het
Caprin1 A G 2: 103,779,423 L170S probably benign Het
Card6 C T 15: 5,099,872 E681K probably benign Het
Catsperb G A 12: 101,480,984 V248I probably benign Het
Ccnj T A 19: 40,837,033 H62Q probably damaging Het
Cd180 A C 13: 102,706,428 I661L probably benign Het
Cdk11b A G 4: 155,647,551 R473G unknown Het
Cep126 T C 9: 8,099,798 T912A possibly damaging Het
Chek2 T A 5: 110,873,514 V530E probably benign Het
Chga G T 12: 102,562,841 S359I probably damaging Het
Cnrip1 T C 11: 17,054,657 V69A probably damaging Het
Cyp2a5 A T 7: 26,842,947 Q458L probably damaging Het
Cyp2j11 T A 4: 96,307,287 T391S possibly damaging Het
Dhx16 T C 17: 35,888,144 L794P probably damaging Het
Dscaml1 A G 9: 45,674,504 T580A probably benign Het
Elmo1 A T 13: 20,280,812 I184L probably benign Het
Gabra1 C T 11: 42,182,294 G51S unknown Het
Gabrr3 C A 16: 59,448,076 L351I possibly damaging Het
Gbp7 A T 3: 142,538,025 N111I probably damaging Het
Gjd2 C T 2: 114,011,102 R298H probably damaging Het
Gm5930 T C 14: 44,336,457 Y141C probably damaging Het
Grin3a G T 4: 49,771,238 N511K probably benign Het
Hdac7 T C 15: 97,810,022 D122G probably benign Het
Ifi204 G A 1: 173,760,137 T152I possibly damaging Het
Lrrc9 C T 12: 72,463,531 probably null Het
Med21 T A 6: 146,642,584 probably benign Het
Mmp19 A T 10: 128,799,083 T523S probably benign Het
Nav3 G A 10: 109,769,212 T1000I probably benign Het
Nin T C 12: 70,044,064 D859G Het
Nip7 T G 8: 107,057,284 L52R possibly damaging Het
Olfr1039 A T 2: 86,131,382 F94I probably damaging Het
Olfr934 A G 9: 38,982,520 Y175H probably damaging Het
Otop1 T A 5: 38,300,203 Y435* probably null Het
Pak4 A G 7: 28,564,956 S174P probably benign Het
Pcsk7 G A 9: 45,925,989 R537Q probably benign Het
Podxl G A 6: 31,529,006 S34F unknown Het
Prr36 G A 8: 4,216,212 R113C probably damaging Het
Ptk7 T C 17: 46,579,599 I436V probably benign Het
Slc13a5 C T 11: 72,266,484 V28I probably benign Het
Slc9a3r2 T A 17: 24,650,208 probably benign Het
Slco6d1 A T 1: 98,421,372 D56V probably benign Het
Spg11 G A 2: 122,055,377 R2317W probably damaging Het
Stom T A 2: 35,323,748 probably null Het
Svs5 T C 2: 164,332,808 L8P possibly damaging Het
Tmem141 C A 2: 25,621,614 V39F probably damaging Het
Tmprss6 A G 15: 78,459,819 L181P probably damaging Het
Tnni3 A G 7: 4,521,380 S40P probably benign Het
Tubgcp4 A G 2: 121,193,984 I548V probably benign Het
Twf2 A G 9: 106,203,939 probably benign Het
Wnt5b C A 6: 119,448,131 probably null Het
Wrap73 A G 4: 154,152,586 D210G probably benign Het
Yipf4 T G 17: 74,489,776 S21A probably benign Het
Zscan20 A G 4: 128,588,150 M573T probably benign Het
Other mutations in Olfr524
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01991:Olfr524 APN 7 140202432 missense probably damaging 1.00
IGL01999:Olfr524 APN 7 140202432 missense probably damaging 1.00
IGL02005:Olfr524 APN 7 140202432 missense probably damaging 1.00
IGL02030:Olfr524 APN 7 140202632 missense probably damaging 0.97
IGL02474:Olfr524 APN 7 140202587 missense probably damaging 1.00
H8441:Olfr524 UTSW 7 140201958 missense possibly damaging 0.81
R0426:Olfr524 UTSW 7 140202116 missense possibly damaging 0.81
R0704:Olfr524 UTSW 7 140202635 missense probably benign 0.00
R0891:Olfr524 UTSW 7 140202459 missense probably damaging 1.00
R1624:Olfr524 UTSW 7 140201951 missense probably damaging 0.96
R1865:Olfr524 UTSW 7 140202372 missense probably damaging 1.00
R1938:Olfr524 UTSW 7 140202231 missense probably benign 0.30
R2105:Olfr524 UTSW 7 140202743 missense probably benign 0.02
R3009:Olfr524 UTSW 7 140202756 missense probably benign
R3546:Olfr524 UTSW 7 140202101 missense probably damaging 1.00
R4849:Olfr524 UTSW 7 140202427 nonsense probably null
R5009:Olfr524 UTSW 7 140201838 missense probably benign
R5105:Olfr524 UTSW 7 140202549 missense probably damaging 1.00
R5413:Olfr524 UTSW 7 140202722 missense possibly damaging 0.94
R5422:Olfr524 UTSW 7 140202392 missense probably damaging 1.00
R7314:Olfr524 UTSW 7 140202413 missense probably damaging 0.99
R7921:Olfr524 UTSW 7 140202299 missense probably damaging 1.00
R8438:Olfr524 UTSW 7 140202257 missense probably damaging 1.00
V1662:Olfr524 UTSW 7 140201958 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- TCATGATGACTGGGTAGCGAAG -3'
(R):5'- GGAACAGCTCAGATGTGACTG -3'

Sequencing Primer
(F):5'- AAGAAGTACAGTTGGGCC -3'
(R):5'- TCAGATGTGACTGAGTTCATCC -3'
Posted On2019-09-13