Mutagenetix > Incidental Mutation

Incidental Mutation 'R7338:Nin'

569659

Institutional Source

Beutler Lab

Gene Symbol

Nin

Ensembl Gene

ENSMUSG00000021068

Gene Name

ninein

Synonyms

3110068G20Rik

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7338 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

70011435-70113717 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 70044064 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 859 (D859G)

Ref Sequence

ENSEMBL: ENSMUSP00000082422 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021468] [ENSMUST00000085314] [ENSMUST00000095666] [ENSMUST00000169074] [ENSMUST00000220689] [ENSMUST00000222237] [ENSMUST00000222835] [ENSMUST00000223257]

AlphaFold

Q61043

Predicted Effect

probably damaging
Transcript: ENSMUST00000021468
AA Change: D859G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000021468
Gene: ENSMUSG00000021068
AA Change: D859G

Domain	Start	End	E-Value	Type
internal_repeat_1	7	67	7.83e-8	PROSPERO
low complexity region	97	108	N/A	INTRINSIC
low complexity region	115	132	N/A	INTRINSIC
internal_repeat_1	181	242	7.83e-8	PROSPERO
low complexity region	276	289	N/A	INTRINSIC
low complexity region	336	353	N/A	INTRINSIC
coiled coil region	358	570	N/A	INTRINSIC
coiled coil region	625	802	N/A	INTRINSIC
coiled coil region	834	926	N/A	INTRINSIC
coiled coil region	957	1008	N/A	INTRINSIC
low complexity region	1035	1044	N/A	INTRINSIC
low complexity region	1047	1057	N/A	INTRINSIC
coiled coil region	1069	1094	N/A	INTRINSIC
coiled coil region	1178	1325	N/A	INTRINSIC
low complexity region	1374	1385	N/A	INTRINSIC
coiled coil region	1425	1806	N/A	INTRINSIC
coiled coil region	1980	2013	N/A	INTRINSIC

Predicted Effect

SMART Domains

Protein: ENSMUSP00000082422
Gene: ENSMUSG00000021068
AA Change: D859G

Domain	Start	End	E-Value	Type
internal_repeat_1	7	67	4.15e-8	PROSPERO
low complexity region	97	108	N/A	INTRINSIC
low complexity region	115	132	N/A	INTRINSIC
internal_repeat_1	181	242	4.15e-8	PROSPERO
low complexity region	276	289	N/A	INTRINSIC
low complexity region	336	353	N/A	INTRINSIC
coiled coil region	358	570	N/A	INTRINSIC
coiled coil region	625	802	N/A	INTRINSIC
coiled coil region	834	926	N/A	INTRINSIC
coiled coil region	957	1008	N/A	INTRINSIC
low complexity region	1035	1044	N/A	INTRINSIC
low complexity region	1047	1057	N/A	INTRINSIC
coiled coil region	1069	1094	N/A	INTRINSIC
coiled coil region	1178	1325	N/A	INTRINSIC
low complexity region	1374	1385	N/A	INTRINSIC
coiled coil region	1425	1806	N/A	INTRINSIC
coiled coil region	1971	2045	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000095666
AA Change: D859G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000093327
Gene: ENSMUSG00000021068
AA Change: D859G

Domain	Start	End	E-Value	Type
internal_repeat_1	7	67	7.83e-8	PROSPERO
low complexity region	97	108	N/A	INTRINSIC
low complexity region	115	132	N/A	INTRINSIC
internal_repeat_1	181	242	7.83e-8	PROSPERO
low complexity region	276	289	N/A	INTRINSIC
low complexity region	336	353	N/A	INTRINSIC
coiled coil region	358	570	N/A	INTRINSIC
coiled coil region	625	802	N/A	INTRINSIC
coiled coil region	834	926	N/A	INTRINSIC
coiled coil region	957	1008	N/A	INTRINSIC
low complexity region	1035	1044	N/A	INTRINSIC
low complexity region	1047	1057	N/A	INTRINSIC
coiled coil region	1069	1094	N/A	INTRINSIC
coiled coil region	1178	1325	N/A	INTRINSIC
low complexity region	1374	1385	N/A	INTRINSIC
coiled coil region	1425	1806	N/A	INTRINSIC
coiled coil region	1980	2013	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000169074
AA Change: D859G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000129648
Gene: ENSMUSG00000021068
AA Change: D859G

Domain	Start	End	E-Value	Type
internal_repeat_1	7	67	7.83e-8	PROSPERO
low complexity region	97	108	N/A	INTRINSIC
low complexity region	115	132	N/A	INTRINSIC
internal_repeat_1	181	242	7.83e-8	PROSPERO
low complexity region	276	289	N/A	INTRINSIC
low complexity region	336	353	N/A	INTRINSIC
coiled coil region	358	570	N/A	INTRINSIC
coiled coil region	625	802	N/A	INTRINSIC
coiled coil region	834	926	N/A	INTRINSIC
coiled coil region	957	1008	N/A	INTRINSIC
low complexity region	1035	1044	N/A	INTRINSIC
low complexity region	1047	1057	N/A	INTRINSIC
coiled coil region	1069	1094	N/A	INTRINSIC
coiled coil region	1178	1325	N/A	INTRINSIC
low complexity region	1374	1385	N/A	INTRINSIC
coiled coil region	1425	1806	N/A	INTRINSIC
coiled coil region	1980	2013	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000220689

Predicted Effect

probably benign
Transcript: ENSMUST00000222835

Predicted Effect

probably damaging
Transcript: ENSMUST00000223257
AA Change: D859G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Meta Mutation Damage Score

0.2039

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

98% (54/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the proteins important for centrosomal function. This protein is important for positioning and anchoring the microtubules minus-ends in epithelial cells. Localization of this protein to the centrosome requires three leucine zippers in the central coiled-coil domain. Multiple alternatively spliced transcript variants that encode different isoforms have been reported. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca3	T	C	17: 24,376,743	S357P	possibly damaging	Het
Arhgap28	T	C	17: 67,896,111	R166G	probably damaging	Het
Bcan	T	A	3: 87,994,243	E384V	probably damaging	Het
Bcl9l	A	G	9: 44,508,708	N1137S	probably benign	Het
Caprin1	A	G	2: 103,779,423	L170S	probably benign	Het
Card6	C	T	15: 5,099,872	E681K	probably benign	Het
Catsperb	G	A	12: 101,480,984	V248I	probably benign	Het
Ccnj	T	A	19: 40,837,033	H62Q	probably damaging	Het
Cd180	A	C	13: 102,706,428	I661L	probably benign	Het
Cdk11b	A	G	4: 155,647,551	R473G	unknown	Het
Cep126	T	C	9: 8,099,798	T912A	possibly damaging	Het
Chek2	T	A	5: 110,873,514	V530E	probably benign	Het
Chga	G	T	12: 102,562,841	S359I	probably damaging	Het
Cnrip1	T	C	11: 17,054,657	V69A	probably damaging	Het
Cyp2a5	A	T	7: 26,842,947	Q458L	probably damaging	Het
Cyp2j11	T	A	4: 96,307,287	T391S	possibly damaging	Het
Dhx16	T	C	17: 35,888,144	L794P	probably damaging	Het
Dscaml1	A	G	9: 45,674,504	T580A	probably benign	Het
Elmo1	A	T	13: 20,280,812	I184L	probably benign	Het
Gabra1	C	T	11: 42,182,294	G51S	unknown	Het
Gabrr3	C	A	16: 59,448,076	L351I	possibly damaging	Het
Gbp7	A	T	3: 142,538,025	N111I	probably damaging	Het
Gjd2	C	T	2: 114,011,102	R298H	probably damaging	Het
Gm5930	T	C	14: 44,336,457	Y141C	probably damaging	Het
Grin3a	G	T	4: 49,771,238	N511K	probably benign	Het
Hdac7	T	C	15: 97,810,022	D122G	probably benign	Het
Ifi204	G	A	1: 173,760,137	T152I	possibly damaging	Het
Lrrc9	C	T	12: 72,463,531		probably null	Het
Med21	T	A	6: 146,642,584		probably benign	Het
Mmp19	A	T	10: 128,799,083	T523S	probably benign	Het
Nav3	G	A	10: 109,769,212	T1000I	probably benign	Het
Nip7	T	G	8: 107,057,284	L52R	possibly damaging	Het
Olfr1039	A	T	2: 86,131,382	F94I	probably damaging	Het
Olfr524	A	T	7: 140,202,533	V79E	probably benign	Het
Olfr934	A	G	9: 38,982,520	Y175H	probably damaging	Het
Otop1	T	A	5: 38,300,203	Y435*	probably null	Het
Pak4	A	G	7: 28,564,956	S174P	probably benign	Het
Pcsk7	G	A	9: 45,925,989	R537Q	probably benign	Het
Podxl	G	A	6: 31,529,006	S34F	unknown	Het
Prr36	G	A	8: 4,216,212	R113C	probably damaging	Het
Ptk7	T	C	17: 46,579,599	I436V	probably benign	Het
Slc13a5	C	T	11: 72,266,484	V28I	probably benign	Het
Slc9a3r2	T	A	17: 24,650,208		probably benign	Het
Slco6d1	A	T	1: 98,421,372	D56V	probably benign	Het
Spg11	G	A	2: 122,055,377	R2317W	probably damaging	Het
Stom	T	A	2: 35,323,748		probably null	Het
Svs5	T	C	2: 164,332,808	L8P	possibly damaging	Het
Tmem141	C	A	2: 25,621,614	V39F	probably damaging	Het
Tmprss6	A	G	15: 78,459,819	L181P	probably damaging	Het
Tnni3	A	G	7: 4,521,380	S40P	probably benign	Het
Tubgcp4	A	G	2: 121,193,984	I548V	probably benign	Het
Twf2	A	G	9: 106,203,939		probably benign	Het
Wnt5b	C	A	6: 119,448,131		probably null	Het
Wrap73	A	G	4: 154,152,586	D210G	probably benign	Het
Yipf4	T	G	17: 74,489,776	S21A	probably benign	Het
Zscan20	A	G	4: 128,588,150	M573T	probably benign	Het

Other mutations in Nin

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00472:Nin	APN	12	70030088	missense	probably damaging	0.98
IGL00677:Nin	APN	12	70026860	missense	probably damaging	1.00
IGL00823:Nin	APN	12	70014793	missense	probably benign	0.01
IGL01103:Nin	APN	12	70056758	missense	probably damaging	0.99
IGL01113:Nin	APN	12	70031779	missense	probably damaging	1.00
IGL01420:Nin	APN	12	70045414	missense	probably benign	0.08
IGL01556:Nin	APN	12	70043188	missense	probably benign	0.01
IGL01663:Nin	APN	12	70043665	missense	possibly damaging	0.72
IGL02002:Nin	APN	12	70062699	nonsense	probably null
IGL02030:Nin	APN	12	70045268	missense	probably damaging	1.00
IGL02202:Nin	APN	12	70055436	missense	probably damaging	1.00
IGL02207:Nin	APN	12	70056657	missense	probably damaging	0.99
IGL02257:Nin	APN	12	70102691	missense	possibly damaging	0.71
IGL02394:Nin	APN	12	70044031	missense	probably damaging	1.00
IGL02531:Nin	APN	12	70020932	missense	probably benign	0.02
IGL03028:Nin	APN	12	70035270	missense	probably benign	0.13
IGL03155:Nin	APN	12	70031770	missense	probably damaging	1.00
IGL03197:Nin	APN	12	70026810	missense	probably benign	0.03
IGL02835:Nin	UTSW	12	70056738	missense	probably damaging	1.00
R0131:Nin	UTSW	12	70051141	missense	probably damaging	1.00
R0131:Nin	UTSW	12	70051141	missense	probably damaging	1.00
R0132:Nin	UTSW	12	70051141	missense	probably damaging	1.00
R0211:Nin	UTSW	12	70014875	missense	probably damaging	1.00
R0211:Nin	UTSW	12	70014875	missense	probably damaging	1.00
R0734:Nin	UTSW	12	70030113	missense	probably benign	0.01
R0947:Nin	UTSW	12	70061186	missense	probably damaging	1.00
R1085:Nin	UTSW	12	70020962	missense	possibly damaging	0.91
R1367:Nin	UTSW	12	70043929	missense	probably damaging	0.99
R1452:Nin	UTSW	12	70017650	nonsense	probably null
R1477:Nin	UTSW	12	70044184	missense	possibly damaging	0.87
R1518:Nin	UTSW	12	70014773	missense	probably benign	0.27
R1566:Nin	UTSW	12	70054479	missense	probably damaging	0.99
R1572:Nin	UTSW	12	70038750	missense	probably damaging	1.00
R1583:Nin	UTSW	12	70031738	missense	probably benign
R1584:Nin	UTSW	12	70042669	missense	probably benign	0.03
R1699:Nin	UTSW	12	70030938	missense	probably benign	0.40
R1699:Nin	UTSW	12	70045563	missense	possibly damaging	0.87
R1765:Nin	UTSW	12	70042891	missense	probably damaging	1.00
R1794:Nin	UTSW	12	70043795	nonsense	probably null
R1952:Nin	UTSW	12	70030926	missense	probably damaging	1.00
R2004:Nin	UTSW	12	70025477	missense	probably benign	0.01
R2025:Nin	UTSW	12	70030008	missense	probably damaging	1.00
R2060:Nin	UTSW	12	70042418	missense	possibly damaging	0.64
R2213:Nin	UTSW	12	70045354	missense	probably damaging	1.00
R2224:Nin	UTSW	12	70061230	missense	probably damaging	1.00
R2247:Nin	UTSW	12	70054545	missense	probably damaging	1.00
R2972:Nin	UTSW	12	70062713	missense	probably damaging	1.00
R3776:Nin	UTSW	12	70038682	missense	possibly damaging	0.71
R3881:Nin	UTSW	12	70042541	missense	probably benign	0.00
R3930:Nin	UTSW	12	70078242	missense	probably damaging	1.00
R3959:Nin	UTSW	12	70050752	missense	probably damaging	1.00
R4229:Nin	UTSW	12	70051210	missense	probably damaging	0.99
R4359:Nin	UTSW	12	70014938	missense	probably benign	0.00
R4423:Nin	UTSW	12	70042978	missense	probably damaging	1.00
R4461:Nin	UTSW	12	70042585	missense	probably benign	0.37
R4639:Nin	UTSW	12	70038601	missense	probably damaging	0.97
R4791:Nin	UTSW	12	70043807	missense	possibly damaging	0.94
R4839:Nin	UTSW	12	70090551	missense	possibly damaging	0.46
R4912:Nin	UTSW	12	70044063	missense	probably damaging	1.00
R5712:Nin	UTSW	12	70042769	missense	probably damaging	1.00
R5726:Nin	UTSW	12	70078179	missense	probably damaging	1.00
R5804:Nin	UTSW	12	70045601	missense	possibly damaging	0.58
R5874:Nin	UTSW	12	70030918	missense	possibly damaging	0.94
R5992:Nin	UTSW	12	70045524	missense	possibly damaging	0.83
R6077:Nin	UTSW	12	70019232	missense	probably damaging	1.00
R6184:Nin	UTSW	12	70043737	missense	probably damaging	1.00
R6307:Nin	UTSW	12	70014857	missense	possibly damaging	0.91
R6315:Nin	UTSW	12	70045615	missense	probably damaging	1.00
R6326:Nin	UTSW	12	70045181	missense	possibly damaging	0.95
R6492:Nin	UTSW	12	70054534	missense	probably benign	0.22
R6562:Nin	UTSW	12	70055954	missense	probably damaging	1.00
R6578:Nin	UTSW	12	70061194	missense	probably damaging	0.99
R6613:Nin	UTSW	12	70030954	missense	probably damaging	1.00
R7112:Nin	UTSW	12	70102799	missense
R7170:Nin	UTSW	12	70044239	missense
R7324:Nin	UTSW	12	70043734	missense
R7372:Nin	UTSW	12	70056029	missense
R7431:Nin	UTSW	12	70078223	missense
R7577:Nin	UTSW	12	70062706	missense
R7655:Nin	UTSW	12	70042768	missense
R7656:Nin	UTSW	12	70042768	missense
R7683:Nin	UTSW	12	70078182	missense
R7769:Nin	UTSW	12	70043230	missense
R7981:Nin	UTSW	12	70042817	missense
R8138:Nin	UTSW	12	70042898	missense
R8141:Nin	UTSW	12	70030021	missense
R8754:Nin	UTSW	12	70031013	intron	probably benign
R8790:Nin	UTSW	12	70021019	missense
R8899:Nin	UTSW	12	70030936	missense	probably damaging	1.00
R8974:Nin	UTSW	12	70078158	missense
R9085:Nin	UTSW	12	70030012	nonsense	probably null
R9143:Nin	UTSW	12	70090575	missense
R9380:Nin	UTSW	12	70028031	missense
R9496:Nin	UTSW	12	70055988	missense
R9638:Nin	UTSW	12	70020844	missense
R9709:Nin	UTSW	12	70102694	missense
R9745:Nin	UTSW	12	70043125	missense
R9792:Nin	UTSW	12	70047235	missense
Z1176:Nin	UTSW	12	70049164	critical splice acceptor site	probably null
Z1177:Nin	UTSW	12	70044095	missense
Z1177:Nin	UTSW	12	70054426	missense

Predicted Primers

PCR Primer
(F):5'- CTTTCAGGTCTTGCAGCAGC -3'
(R):5'- CAGCAGTCTCAGTAATGCTGTC -3'

Sequencing Primer
(F):5'- GCAGCTGCTTTCTTTCCGTG -3'
(R):5'- AGTAATGCTGTCTGTTGACCAC -3'

Posted On

2019-09-13