Incidental Mutation 'R7338:Cd180'
ID569663
Institutional Source Beutler Lab
Gene Symbol Cd180
Ensembl Gene ENSMUSG00000021624
Gene NameCD180 antigen
SynonymsLy78, RP105
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7338 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location102693558-102739629 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 102706428 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 661 (I661L)
Ref Sequence ENSEMBL: ENSMUSP00000022124 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022124] [ENSMUST00000167144] [ENSMUST00000170878] [ENSMUST00000171267] [ENSMUST00000172138]
PDB Structure
Crystal structure of mouse RP105/MD-1 complex [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000022124
AA Change: I661L

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000022124
Gene: ENSMUSG00000021624
AA Change: I661L

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
LRR 76 99 1.07e0 SMART
LRR 193 221 1.76e2 SMART
LRR 297 320 1.66e1 SMART
Pfam:LRR_8 321 382 4.2e-13 PFAM
LRR 395 418 3e1 SMART
LRR 444 467 3.09e1 SMART
LRR 495 518 4.97e0 SMART
LRR 519 542 2.4e1 SMART
low complexity region 555 567 N/A INTRINSIC
LRRCT 577 626 5.11e-8 SMART
transmembrane domain 628 650 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167144
SMART Domains Protein: ENSMUSP00000133015
Gene: ENSMUSG00000021624

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170878
SMART Domains Protein: ENSMUSP00000127880
Gene: ENSMUSG00000021624

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
PDB:3T6Q|B 21 86 3e-38 PDB
SCOP:d1m0za_ 35 84 4e-4 SMART
Blast:LRR 51 75 1e-5 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000171267
SMART Domains Protein: ENSMUSP00000129096
Gene: ENSMUSG00000021624

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
PDB:3T6Q|B 21 86 2e-38 PDB
SCOP:d1m0za_ 35 84 9e-4 SMART
Blast:LRR 51 75 7e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000172138
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] CD180 is a cell surface molecule consisting of extracellular leucine-rich repeats (LRR) and a short cytoplasmic tail. The extracellular LRR is associated with a molecule called MD-1 and form the cell surface receptor complex, RP105/MD-1. It belongs to the family of pathogen receptors, Toll-like receptors (TLR). RP105/MD1, by working in concert with TLR4, controls B cell recognition and signaling of lipopolysaccharide (LPS), a membrane constituent of Gram-negative bacteria. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation showed impaired proliferative and humoral immune responses of B cells to lipopolysaccharides. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T C 17: 24,376,743 S357P possibly damaging Het
Arhgap28 T C 17: 67,896,111 R166G probably damaging Het
Bcan T A 3: 87,994,243 E384V probably damaging Het
Bcl9l A G 9: 44,508,708 N1137S probably benign Het
Caprin1 A G 2: 103,779,423 L170S probably benign Het
Card6 C T 15: 5,099,872 E681K probably benign Het
Catsperb G A 12: 101,480,984 V248I probably benign Het
Ccnj T A 19: 40,837,033 H62Q probably damaging Het
Cdk11b A G 4: 155,647,551 R473G unknown Het
Cep126 T C 9: 8,099,798 T912A possibly damaging Het
Chek2 T A 5: 110,873,514 V530E probably benign Het
Chga G T 12: 102,562,841 S359I probably damaging Het
Cnrip1 T C 11: 17,054,657 V69A probably damaging Het
Cyp2a5 A T 7: 26,842,947 Q458L probably damaging Het
Cyp2j11 T A 4: 96,307,287 T391S possibly damaging Het
Dhx16 T C 17: 35,888,144 L794P probably damaging Het
Dscaml1 A G 9: 45,674,504 T580A probably benign Het
Elmo1 A T 13: 20,280,812 I184L probably benign Het
Gabra1 C T 11: 42,182,294 G51S unknown Het
Gabrr3 C A 16: 59,448,076 L351I possibly damaging Het
Gbp7 A T 3: 142,538,025 N111I probably damaging Het
Gjd2 C T 2: 114,011,102 R298H probably damaging Het
Gm5930 T C 14: 44,336,457 Y141C probably damaging Het
Grin3a G T 4: 49,771,238 N511K probably benign Het
Hdac7 T C 15: 97,810,022 D122G probably benign Het
Ifi204 G A 1: 173,760,137 T152I possibly damaging Het
Lrrc9 C T 12: 72,463,531 probably null Het
Med21 T A 6: 146,642,584 probably benign Het
Mmp19 A T 10: 128,799,083 T523S probably benign Het
Nav3 G A 10: 109,769,212 T1000I probably benign Het
Nin T C 12: 70,044,064 D859G Het
Nip7 T G 8: 107,057,284 L52R possibly damaging Het
Olfr1039 A T 2: 86,131,382 F94I probably damaging Het
Olfr524 A T 7: 140,202,533 V79E probably benign Het
Olfr934 A G 9: 38,982,520 Y175H probably damaging Het
Otop1 T A 5: 38,300,203 Y435* probably null Het
Pak4 A G 7: 28,564,956 S174P probably benign Het
Pcsk7 G A 9: 45,925,989 R537Q probably benign Het
Podxl G A 6: 31,529,006 S34F unknown Het
Prr36 G A 8: 4,216,212 R113C probably damaging Het
Ptk7 T C 17: 46,579,599 I436V probably benign Het
Slc13a5 C T 11: 72,266,484 V28I probably benign Het
Slc9a3r2 T A 17: 24,650,208 probably benign Het
Slco6d1 A T 1: 98,421,372 D56V probably benign Het
Spg11 G A 2: 122,055,377 R2317W probably damaging Het
Stom T A 2: 35,323,748 probably null Het
Svs5 T C 2: 164,332,808 L8P possibly damaging Het
Tmem141 C A 2: 25,621,614 V39F probably damaging Het
Tmprss6 A G 15: 78,459,819 L181P probably damaging Het
Tnni3 A G 7: 4,521,380 S40P probably benign Het
Tubgcp4 A G 2: 121,193,984 I548V probably benign Het
Twf2 A G 9: 106,203,939 probably benign Het
Wnt5b C A 6: 119,448,131 probably null Het
Wrap73 A G 4: 154,152,586 D210G probably benign Het
Yipf4 T G 17: 74,489,776 S21A probably benign Het
Zscan20 A G 4: 128,588,150 M573T probably benign Het
Other mutations in Cd180
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00778:Cd180 APN 13 102705409 missense probably benign
IGL00949:Cd180 APN 13 102693760 missense possibly damaging 0.89
IGL01864:Cd180 APN 13 102706033 missense possibly damaging 0.93
IGL01901:Cd180 APN 13 102706428 missense probably benign 0.04
IGL01934:Cd180 APN 13 102702858 missense probably damaging 1.00
IGL01998:Cd180 APN 13 102705214 missense probably damaging 0.99
IGL02336:Cd180 APN 13 102705313 missense probably damaging 0.98
IGL03031:Cd180 APN 13 102705027 missense probably benign 0.00
IGL03139:Cd180 APN 13 102706416 missense probably damaging 1.00
Volte_face UTSW 13 102704923 missense probably damaging 0.99
H8562:Cd180 UTSW 13 102705418 missense probably benign 0.02
R0004:Cd180 UTSW 13 102702708 missense probably benign 0.00
R0393:Cd180 UTSW 13 102705900 missense probably damaging 0.99
R0565:Cd180 UTSW 13 102702874 intron probably benign
R1080:Cd180 UTSW 13 102706220 nonsense probably null
R1223:Cd180 UTSW 13 102706222 missense possibly damaging 0.49
R1669:Cd180 UTSW 13 102705490 missense probably damaging 1.00
R1772:Cd180 UTSW 13 102706242 missense probably benign 0.11
R1784:Cd180 UTSW 13 102705859 missense probably damaging 1.00
R1865:Cd180 UTSW 13 102706009 missense probably benign
R2252:Cd180 UTSW 13 102706398 nonsense probably null
R2385:Cd180 UTSW 13 102705183 missense probably benign 0.00
R4653:Cd180 UTSW 13 102704908 missense probably damaging 1.00
R4695:Cd180 UTSW 13 102705760 missense probably benign 0.01
R4790:Cd180 UTSW 13 102702822 missense probably damaging 0.98
R4934:Cd180 UTSW 13 102739164 critical splice acceptor site probably null
R5052:Cd180 UTSW 13 102704895 missense probably benign
R5154:Cd180 UTSW 13 102705774 missense probably damaging 1.00
R5469:Cd180 UTSW 13 102704834 missense probably benign 0.37
R5493:Cd180 UTSW 13 102706141 missense probably benign 0.07
R5615:Cd180 UTSW 13 102706203 missense probably benign 0.34
R5905:Cd180 UTSW 13 102706033 missense possibly damaging 0.93
R6282:Cd180 UTSW 13 102693757 missense possibly damaging 0.90
R6433:Cd180 UTSW 13 102705633 missense probably benign 0.00
R6456:Cd180 UTSW 13 102702836 missense probably damaging 1.00
R6784:Cd180 UTSW 13 102702705 missense probably damaging 0.97
R6815:Cd180 UTSW 13 102705429 missense probably damaging 1.00
R6838:Cd180 UTSW 13 102702731 missense probably benign 0.38
R6941:Cd180 UTSW 13 102706191 missense probably benign 0.23
R7048:Cd180 UTSW 13 102704923 missense probably damaging 0.99
R7466:Cd180 UTSW 13 102704995 missense probably damaging 1.00
R7647:Cd180 UTSW 13 102705943 missense probably damaging 1.00
R8179:Cd180 UTSW 13 102705633 missense probably benign 0.00
R8252:Cd180 UTSW 13 102705996 missense probably benign 0.00
R8300:Cd180 UTSW 13 102704793 missense probably benign 0.01
R8460:Cd180 UTSW 13 102702846 missense probably damaging 1.00
Z1176:Cd180 UTSW 13 102705766 missense probably damaging 1.00
Z1177:Cd180 UTSW 13 102706032 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GACACTCTTTGCGAAAATCCC -3'
(R):5'- CAGATGGGTAGAGCTGACTGTG -3'

Sequencing Primer
(F):5'- GAAAATCCCCCATTGCTGAGGG -3'
(R):5'- GTGTCTCACAGCCATGTCTGG -3'
Posted On2019-09-13