Incidental Mutation 'R7338:Slc9a3r2'
ID569670
Institutional Source Beutler Lab
Gene Symbol Slc9a3r2
Ensembl Gene ENSMUSG00000002504
Gene Namesolute carrier family 9 (sodium/hydrogen exchanger), member 3 regulator 2
SynonymsSip1, 0610011L07Rik, Sryip1, Nherf2, Octs2, Tka-1, Sip-1, E3karp, 2010007A20Rik, 1200011K07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7338 (G1)
Quality Score94.0077
Status Not validated
Chromosome17
Chromosomal Location24639282-24650305 bp(-) (GRCm38)
Type of Mutationstart gained
DNA Base Change (assembly) T to A at 24650208 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000002572 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002572]
Predicted Effect probably benign
Transcript: ENSMUST00000002572
SMART Domains Protein: ENSMUSP00000002572
Gene: ENSMUSG00000002504

DomainStartEndE-ValueType
PDZ 19 91 6.31e-21 SMART
PDZ 159 231 8.79e-20 SMART
Pfam:EBP50_C 232 284 5.1e-13 PFAM
Pfam:EBP50_C 261 337 2.3e-22 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the NHERF family of PDZ scaffolding proteins. These proteins mediate many cellular processes by binding to and regulating the membrane expression and protein-protein interactions of membrane receptors and transport proteins. The encoded protein plays a role in intestinal sodium absorption by regulating the activity of the sodium/hydrogen exchanger 3, and may also regulate the cystic fibrosis transmembrane regulator (CFTR) ion channel. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Mice homozygous for a null allele are viable, fertile and overtly normal and display normal cAMP- and cGMP-activated CFTR transepithelial chloride transport and bicarbonate secretion in the small intestine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T C 17: 24,376,743 S357P possibly damaging Het
Arhgap28 T C 17: 67,896,111 R166G probably damaging Het
Bcan T A 3: 87,994,243 E384V probably damaging Het
Bcl9l A G 9: 44,508,708 N1137S probably benign Het
Caprin1 A G 2: 103,779,423 L170S probably benign Het
Card6 C T 15: 5,099,872 E681K probably benign Het
Catsperb G A 12: 101,480,984 V248I probably benign Het
Ccnj T A 19: 40,837,033 H62Q probably damaging Het
Cd180 A C 13: 102,706,428 I661L probably benign Het
Cdk11b A G 4: 155,647,551 R473G unknown Het
Cep126 T C 9: 8,099,798 T912A possibly damaging Het
Chek2 T A 5: 110,873,514 V530E probably benign Het
Chga G T 12: 102,562,841 S359I probably damaging Het
Cnrip1 T C 11: 17,054,657 V69A probably damaging Het
Cyp2a5 A T 7: 26,842,947 Q458L probably damaging Het
Cyp2j11 T A 4: 96,307,287 T391S possibly damaging Het
Dhx16 T C 17: 35,888,144 L794P probably damaging Het
Dscaml1 A G 9: 45,674,504 T580A probably benign Het
Elmo1 A T 13: 20,280,812 I184L probably benign Het
Gabra1 C T 11: 42,182,294 G51S unknown Het
Gabrr3 C A 16: 59,448,076 L351I possibly damaging Het
Gbp7 A T 3: 142,538,025 N111I probably damaging Het
Gjd2 C T 2: 114,011,102 R298H probably damaging Het
Gm5930 T C 14: 44,336,457 Y141C probably damaging Het
Grin3a G T 4: 49,771,238 N511K probably benign Het
Hdac7 T C 15: 97,810,022 D122G probably benign Het
Ifi204 G A 1: 173,760,137 T152I possibly damaging Het
Lrrc9 C T 12: 72,463,531 probably null Het
Med21 T A 6: 146,642,584 probably benign Het
Mmp19 A T 10: 128,799,083 T523S probably benign Het
Nav3 G A 10: 109,769,212 T1000I probably benign Het
Nin T C 12: 70,044,064 D859G Het
Nip7 T G 8: 107,057,284 L52R possibly damaging Het
Olfr1039 A T 2: 86,131,382 F94I probably damaging Het
Olfr524 A T 7: 140,202,533 V79E probably benign Het
Olfr934 A G 9: 38,982,520 Y175H probably damaging Het
Otop1 T A 5: 38,300,203 Y435* probably null Het
Pak4 A G 7: 28,564,956 S174P probably benign Het
Pcsk7 G A 9: 45,925,989 R537Q probably benign Het
Podxl G A 6: 31,529,006 S34F unknown Het
Prr36 G A 8: 4,216,212 R113C probably damaging Het
Ptk7 T C 17: 46,579,599 I436V probably benign Het
Slc13a5 C T 11: 72,266,484 V28I probably benign Het
Slco6d1 A T 1: 98,421,372 D56V probably benign Het
Spg11 G A 2: 122,055,377 R2317W probably damaging Het
Stom T A 2: 35,323,748 probably null Het
Svs5 T C 2: 164,332,808 L8P possibly damaging Het
Tmem141 C A 2: 25,621,614 V39F probably damaging Het
Tmprss6 A G 15: 78,459,819 L181P probably damaging Het
Tnni3 A G 7: 4,521,380 S40P probably benign Het
Tubgcp4 A G 2: 121,193,984 I548V probably benign Het
Twf2 A G 9: 106,203,939 probably benign Het
Wnt5b C A 6: 119,448,131 probably null Het
Wrap73 A G 4: 154,152,586 D210G probably benign Het
Yipf4 T G 17: 74,489,776 S21A probably benign Het
Zscan20 A G 4: 128,588,150 M573T probably benign Het
Other mutations in Slc9a3r2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02676:Slc9a3r2 APN 17 24641956 missense probably damaging 1.00
R1843:Slc9a3r2 UTSW 17 24641719 missense possibly damaging 0.75
R2199:Slc9a3r2 UTSW 17 24640596 missense probably null 0.37
R2912:Slc9a3r2 UTSW 17 24642241 missense probably damaging 1.00
R4774:Slc9a3r2 UTSW 17 24644899 start codon destroyed probably null 0.01
R5352:Slc9a3r2 UTSW 17 24642255 missense probably damaging 1.00
R5356:Slc9a3r2 UTSW 17 24641971 missense probably damaging 1.00
R5562:Slc9a3r2 UTSW 17 24641824 missense probably benign 0.06
R5841:Slc9a3r2 UTSW 17 24644877 missense probably benign
R7231:Slc9a3r2 UTSW 17 24650104 missense probably damaging 1.00
R7539:Slc9a3r2 UTSW 17 24641899 missense probably damaging 0.99
R8276:Slc9a3r2 UTSW 17 24642260 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCTACGTTGACGCCGTTGAC -3'
(R):5'- TTGCCTGACCAAGCAATCC -3'

Sequencing Primer
(F):5'- TGAAAGCCGTACCCTTG -3'
(R):5'- AAGCAATCCCACTCCTTGGTC -3'
Posted On2019-09-13