Mutagenetix > Incidental Mutations

Incidental Mutation 'R7338:Ptk7'

569672

Institutional Source

Beutler Lab

Gene Symbol

Ptk7

Ensembl Gene

ENSMUSG00000023972

Gene Name

PTK7 protein tyrosine kinase 7

Synonyms

8430404F20Rik, mPTK7/CCK4, chz

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7338 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

46564451-46629504 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 46579599 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 436 (I436V)

Ref Sequence

ENSEMBL: ENSMUSP00000043703 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044442]

Predicted Effect

probably benign
Transcript: ENSMUST00000044442
AA Change: I436V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000043703
Gene: ENSMUSG00000023972
AA Change: I436V

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
IGc2	36	100	1.48e-6	SMART
IGc2	133	199	8.12e-13	SMART
IGc2	229	300	5.01e-4	SMART
IGc2	326	390	1.96e-6	SMART
IG	410	491	6.02e-7	SMART
IGc2	507	569	1.19e-10	SMART
IGc2	596	663	2.6e-11	SMART
transmembrane domain	696	718	N/A	INTRINSIC
TyrKc	788	1053	4.34e-115	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

98% (54/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the receptor protein tyrosine kinase family of proteins that transduce extracellular signals across the cell membrane. The encoded protein lacks detectable catalytic tyrosine kinase activity, is involved in the Wnt signaling pathway and plays a role in multiple cellular processes including polarity and adhesion. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a gene trapped allele die perinatally with defects in neural tube closure and planar cell polarity in the ear. ENU-induced mutant mice show omphalocele, impaired neural tube, heart and lung development, rib defects, polydactyly, failed eyelid closure and altered cell polarity. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca3	T	C	17: 24,376,743	S357P	possibly damaging	Het
Arhgap28	T	C	17: 67,896,111	R166G	probably damaging	Het
Bcan	T	A	3: 87,994,243	E384V	probably damaging	Het
Bcl9l	A	G	9: 44,508,708	N1137S	probably benign	Het
Caprin1	A	G	2: 103,779,423	L170S	probably benign	Het
Card6	C	T	15: 5,099,872	E681K	probably benign	Het
Catsperb	G	A	12: 101,480,984	V248I	probably benign	Het
Ccnj	T	A	19: 40,837,033	H62Q	probably damaging	Het
Cd180	A	C	13: 102,706,428	I661L	probably benign	Het
Cdk11b	A	G	4: 155,647,551	R473G	unknown	Het
Cep126	T	C	9: 8,099,798	T912A	possibly damaging	Het
Chek2	T	A	5: 110,873,514	V530E	probably benign	Het
Chga	G	T	12: 102,562,841	S359I	probably damaging	Het
Cnrip1	T	C	11: 17,054,657	V69A	probably damaging	Het
Cyp2a5	A	T	7: 26,842,947	Q458L	probably damaging	Het
Cyp2j11	T	A	4: 96,307,287	T391S	possibly damaging	Het
Dhx16	T	C	17: 35,888,144	L794P	probably damaging	Het
Dscaml1	A	G	9: 45,674,504	T580A	probably benign	Het
Elmo1	A	T	13: 20,280,812	I184L	probably benign	Het
Gabra1	C	T	11: 42,182,294	G51S	unknown	Het
Gabrr3	C	A	16: 59,448,076	L351I	possibly damaging	Het
Gbp7	A	T	3: 142,538,025	N111I	probably damaging	Het
Gjd2	C	T	2: 114,011,102	R298H	probably damaging	Het
Gm5930	T	C	14: 44,336,457	Y141C	probably damaging	Het
Grin3a	G	T	4: 49,771,238	N511K	probably benign	Het
Hdac7	T	C	15: 97,810,022	D122G	probably benign	Het
Ifi204	G	A	1: 173,760,137	T152I	possibly damaging	Het
Lrrc9	C	T	12: 72,463,531		probably null	Het
Med21	T	A	6: 146,642,584		probably benign	Het
Mmp19	A	T	10: 128,799,083	T523S	probably benign	Het
Nav3	G	A	10: 109,769,212	T1000I	probably benign	Het
Nin	T	C	12: 70,044,064	D859G		Het
Nip7	T	G	8: 107,057,284	L52R	possibly damaging	Het
Olfr1039	A	T	2: 86,131,382	F94I	probably damaging	Het
Olfr524	A	T	7: 140,202,533	V79E	probably benign	Het
Olfr934	A	G	9: 38,982,520	Y175H	probably damaging	Het
Otop1	T	A	5: 38,300,203	Y435*	probably null	Het
Pak4	A	G	7: 28,564,956	S174P	probably benign	Het
Pcsk7	G	A	9: 45,925,989	R537Q	probably benign	Het
Podxl	G	A	6: 31,529,006	S34F	unknown	Het
Prr36	G	A	8: 4,216,212	R113C	probably damaging	Het
Slc13a5	C	T	11: 72,266,484	V28I	probably benign	Het
Slc9a3r2	T	A	17: 24,650,208		probably benign	Het
Slco6d1	A	T	1: 98,421,372	D56V	probably benign	Het
Spg11	G	A	2: 122,055,377	R2317W	probably damaging	Het
Stom	T	A	2: 35,323,748		probably null	Het
Svs5	T	C	2: 164,332,808	L8P	possibly damaging	Het
Tmem141	C	A	2: 25,621,614	V39F	probably damaging	Het
Tmprss6	A	G	15: 78,459,819	L181P	probably damaging	Het
Tnni3	A	G	7: 4,521,380	S40P	probably benign	Het
Tubgcp4	A	G	2: 121,193,984	I548V	probably benign	Het
Twf2	A	G	9: 106,203,939		probably benign	Het
Wnt5b	C	A	6: 119,448,131		probably null	Het
Wrap73	A	G	4: 154,152,586	D210G	probably benign	Het
Yipf4	T	G	17: 74,489,776	S21A	probably benign	Het
Zscan20	A	G	4: 128,588,150	M573T	probably benign	Het

Other mutations in Ptk7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00427:Ptk7	APN	17	46574427	missense	probably damaging	1.00
IGL01064:Ptk7	APN	17	46573566	nonsense	probably null
IGL01444:Ptk7	APN	17	46565387	missense	probably damaging	1.00
IGL01477:Ptk7	APN	17	46576880	missense	possibly damaging	0.61
IGL01727:Ptk7	APN	17	46572548	missense	probably damaging	1.00
IGL01958:Ptk7	APN	17	46579427	missense	probably benign	0.37
IGL02496:Ptk7	APN	17	46590144	missense	probably benign	0.04
IGL02864:Ptk7	APN	17	46572733	missense	probably damaging	1.00
R0008:Ptk7	UTSW	17	46572762	splice site	probably benign
R0671:Ptk7	UTSW	17	46590312	missense	possibly damaging	0.94
R1464:Ptk7	UTSW	17	46572591	missense	probably damaging	1.00
R1464:Ptk7	UTSW	17	46572591	missense	probably damaging	1.00
R1549:Ptk7	UTSW	17	46572652	missense	probably damaging	1.00
R1635:Ptk7	UTSW	17	46573534	missense	possibly damaging	0.81
R1646:Ptk7	UTSW	17	46586297	missense	probably benign	0.44
R1846:Ptk7	UTSW	17	46576490	critical splice donor site	probably null
R1973:Ptk7	UTSW	17	46586807	nonsense	probably null
R2060:Ptk7	UTSW	17	46566238	missense	possibly damaging	0.83
R2155:Ptk7	UTSW	17	46579617	missense	probably benign	0.09
R2472:Ptk7	UTSW	17	46576848	missense	probably benign	0.35
R2937:Ptk7	UTSW	17	46572550	missense	probably damaging	0.99
R3824:Ptk7	UTSW	17	46565378	missense	probably damaging	1.00
R3845:Ptk7	UTSW	17	46586418	missense	probably benign	0.00
R4222:Ptk7	UTSW	17	46574463	missense	probably benign
R4671:Ptk7	UTSW	17	46574466	missense	probably benign
R4922:Ptk7	UTSW	17	46576491	critical splice donor site	probably null
R5319:Ptk7	UTSW	17	46572677	missense	probably damaging	1.00
R5993:Ptk7	UTSW	17	46565370	missense	probably benign
R6254:Ptk7	UTSW	17	46572642	missense	probably damaging	1.00
R6352:Ptk7	UTSW	17	46576890	missense	probably benign	0.00
R6806:Ptk7	UTSW	17	46573528	missense	probably damaging	0.99
R7394:Ptk7	UTSW	17	46591757	missense	probably damaging	1.00
R7709:Ptk7	UTSW	17	46571643	missense	possibly damaging	0.81
R7949:Ptk7	UTSW	17	46586461	missense	possibly damaging	0.64
R8773:Ptk7	UTSW	17	46566267	missense	possibly damaging	0.88

Predicted Primers

PCR Primer
(F):5'- TGATGCGCAAGGTCCCATTC -3'
(R):5'- AGCACCAGTGACTTAGAACTC -3'

Sequencing Primer
(F):5'- GCAAGGTCCCATTCTTCGAAAC -3'
(R):5'- CCAGTGACTTAGAACTCTGTGATTG -3'

Posted On

2019-09-13