Incidental Mutation 'R7339:Nek6'
ID 569678
Institutional Source Beutler Lab
Gene Symbol Nek6
Ensembl Gene ENSMUSG00000026749
Gene Name NIMA (never in mitosis gene a)-related expressed kinase 6
Synonyms 1300007C09Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock # R7339 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 38511643-38594606 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 38560965 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Threonine at position 127 (A127T)
Ref Sequence ENSEMBL: ENSMUSP00000049723 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054234] [ENSMUST00000112895] [ENSMUST00000112902] [ENSMUST00000151683] [ENSMUST00000156726]
AlphaFold Q9ES70
Predicted Effect probably damaging
Transcript: ENSMUST00000054234
AA Change: A127T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000049723
Gene: ENSMUSG00000026749
AA Change: A127T

DomainStartEndE-ValueType
S_TKc 45 310 3.01e-91 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112895
AA Change: A127T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000108516
Gene: ENSMUSG00000026749
AA Change: A127T

DomainStartEndE-ValueType
S_TKc 45 310 3.01e-91 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112902
AA Change: A116T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108523
Gene: ENSMUSG00000026749
AA Change: A116T

DomainStartEndE-ValueType
S_TKc 34 299 3.01e-91 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000151683
Predicted Effect probably benign
Transcript: ENSMUST00000156726
SMART Domains Protein: ENSMUSP00000114376
Gene: ENSMUSG00000026749

DomainStartEndE-ValueType
Pfam:Pkinase 45 108 6.6e-13 PFAM
Pfam:Pkinase_Tyr 45 108 1.5e-9 PFAM
Meta Mutation Damage Score 0.4221 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (61/61)
MGI Phenotype Strain: 5427679
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a kinase required for progression through the metaphase portion of mitosis. Inhibition of the encoded protein can lead to apoptosis. This protein also can enhance tumorigenesis by suppressing tumor cell senescence. Several transcript variants encoding a few different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: No significant homozygous or heterozygous mutant phenotype was detected in a high throughput screen of a targeted mutation, however these homozygotes exhibit an increased response of the heart to induced stress, with aggravated cardiac hypertrophy. [provided by MGI curators]
Allele List at MGI

All alleles(128) : Targeted(3) Gene trapped(125)

Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik G A 11: 78,272,384 probably null Het
2900026A02Rik T C 5: 113,183,072 D1092G probably benign Het
9030624J02Rik A T 7: 118,809,971 I612F probably damaging Het
Abcb11 C T 2: 69,299,867 D282N probably damaging Het
Ahnak A T 19: 9,008,165 N2271I possibly damaging Het
Amz1 A G 5: 140,741,551 S90G probably benign Het
Arhgap5 A G 12: 52,517,698 E484G possibly damaging Het
Arid3c A G 4: 41,729,883 probably null Het
Atp1a1 T C 3: 101,589,872 I373V probably benign Het
Barhl1 T C 2: 28,909,887 E242G probably damaging Het
Cactin CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG 10: 81,321,318 probably benign Het
Casz1 T A 4: 148,951,745 V1488E probably damaging Het
Ccdc175 C A 12: 72,136,041 Q401H probably damaging Het
Cfap36 T C 11: 29,225,925 Y191C probably benign Het
Chmp2b G A 16: 65,545,346 Q119* probably null Het
Cps1 T A 1: 67,197,015 I969N possibly damaging Het
Dennd5a A G 7: 109,901,159 F920L probably damaging Het
Dnah12 A T 14: 26,872,320 T3410S probably benign Het
Fbxo42 T G 4: 141,200,144 S578R possibly damaging Het
Fcgr1 C T 3: 96,284,299 G398R not run Het
Foxa3 A T 7: 19,014,869 Y111N probably damaging Het
Gabbr2 T C 4: 46,846,340 K190E probably benign Het
Gbp10 T C 5: 105,220,098 Y403C possibly damaging Het
Gm906 A T 13: 50,247,168 I374N possibly damaging Het
Hsd3b5 A G 3: 98,622,074 I80T probably damaging Het
Kri1 T G 9: 21,286,587 Q89P Het
Lrp6 G T 6: 134,450,818 P1604T probably damaging Het
Metap1 T C 3: 138,466,137 probably null Het
Mkrn3 C T 7: 62,419,782 R87H probably benign Het
Ms4a6d G A 19: 11,590,073 Q155* probably null Het
Myh6 T C 14: 54,961,568 probably null Het
Naip6 G T 13: 100,316,019 P178Q probably damaging Het
Ncapg2 A G 12: 116,414,834 E160G probably damaging Het
Nell1 T C 7: 50,279,549 V264A probably benign Het
Nlrp2 T A 7: 5,327,628 I590F possibly damaging Het
Olfr1308 A T 2: 111,960,611 M154K probably benign Het
Olfr1310 A G 2: 112,008,475 L237P probably damaging Het
Olfr1390 G A 11: 49,341,048 R172Q not run Het
Olfr503 A C 7: 108,544,900 D125A probably damaging Het
Olfr71 C T 4: 43,706,080 A163T probably benign Het
Otop3 T A 11: 115,346,378 L556Q probably damaging Het
Padi1 T C 4: 140,829,234 D190G probably null Het
Pald1 T C 10: 61,323,331 S774G possibly damaging Het
Pde10a C T 17: 8,757,028 T55I probably benign Het
Pla2g4d T C 2: 120,278,978 M197V probably benign Het
Prom1 C A 5: 44,101,653 probably benign Het
Ptdss1 A G 13: 66,963,362 H164R possibly damaging Het
Rrh A T 3: 129,810,613 I313N probably damaging Het
Slc35b4 A G 6: 34,167,656 I88T probably damaging Het
Slc38a11 C T 2: 65,326,570 V353I probably benign Het
Spdef T A 17: 27,720,245 E42D probably benign Het
Tgoln1 G C 6: 72,616,278 T73R probably benign Het
Tmx1 A G 12: 70,458,850 D129G probably benign Het
Trav13n-4 A T 14: 53,363,978 Y68F probably benign Het
Trp53 T C 11: 69,589,189 S238P probably damaging Het
Trp53bp1 T C 2: 121,236,469 D592G probably benign Het
Ttll5 T C 12: 85,857,464 probably null Het
Urb1 CACTTAC CAC 16: 90,772,573 probably benign Het
Vmn2r43 A T 7: 8,255,307 Y302* probably null Het
Vps13d C T 4: 145,121,368 V2478I Het
Wsb1 A G 11: 79,240,358 V404A probably damaging Het
Zfc3h1 A G 10: 115,403,300 D539G probably damaging Het
Zfp318 T C 17: 46,411,247 V1392A probably damaging Het
Other mutations in Nek6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03112:Nek6 APN 2 38560902 missense probably damaging 1.00
P0005:Nek6 UTSW 2 38569737 critical splice donor site probably null
R0014:Nek6 UTSW 2 38558844 splice site probably benign
R0674:Nek6 UTSW 2 38558904 missense possibly damaging 0.79
R0709:Nek6 UTSW 2 38557846 missense probably damaging 0.99
R0835:Nek6 UTSW 2 38569631 missense possibly damaging 0.76
R1548:Nek6 UTSW 2 38568895 missense probably damaging 0.99
R1773:Nek6 UTSW 2 38582419 missense probably benign 0.25
R1901:Nek6 UTSW 2 38582446 missense probably damaging 1.00
R4080:Nek6 UTSW 2 38550637 missense probably damaging 0.99
R4563:Nek6 UTSW 2 38585293 missense probably damaging 1.00
R6207:Nek6 UTSW 2 38557834 missense possibly damaging 0.82
R6865:Nek6 UTSW 2 38569666 missense probably benign
R8536:Nek6 UTSW 2 38514785 splice site probably null
Predicted Primers PCR Primer
(F):5'- ACTTCAGTGAAGCCAGGAGC -3'
(R):5'- CCAGGCATCATCCTATACAGG -3'

Sequencing Primer
(F):5'- AGGAGCTGAGCCTGAGC -3'
(R):5'- GGCATCATCCTATACAGGCATCATTC -3'
Posted On 2019-09-13