Incidental Mutation 'R0639:Morc3'
Institutional Source Beutler Lab
Gene Symbol Morc3
Ensembl Gene ENSMUSG00000039456
Gene Namemicrorchidia 3
SynonymsZcwcc3, 1110051N18Rik, 1110051N18Rik, D16Jhu32e
MMRRC Submission 038828-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0639 (G1)
Quality Score195
Status Not validated
Chromosomal Location93832121-93876073 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 93853850 bp
Amino Acid Change Histidine to Glutamine at position 319 (H319Q)
Ref Sequence ENSEMBL: ENSMUSP00000144369 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044068] [ENSMUST00000201097] [ENSMUST00000201754] [ENSMUST00000202261]
Predicted Effect probably damaging
Transcript: ENSMUST00000044068
AA Change: H319Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000040152
Gene: ENSMUSG00000039456
AA Change: H319Q

Pfam:HATPase_c 25 130 8e-8 PFAM
Pfam:HATPase_c_3 26 164 1.1e-18 PFAM
Pfam:zf-CW 409 452 2.7e-19 PFAM
low complexity region 461 472 N/A INTRINSIC
low complexity region 630 639 N/A INTRINSIC
coiled coil region 765 871 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000201097
AA Change: H248Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144058
Gene: ENSMUSG00000039456
AA Change: H248Q

Blast:HATPase_c 1 70 4e-39 BLAST
Pfam:zf-CW 340 383 1.2e-16 PFAM
low complexity region 392 403 N/A INTRINSIC
low complexity region 557 566 N/A INTRINSIC
coiled coil region 692 798 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201706
Predicted Effect probably benign
Transcript: ENSMUST00000201754
SMART Domains Protein: ENSMUSP00000144357
Gene: ENSMUSG00000039456

Pfam:HATPase_c 25 91 1.3e-6 PFAM
Pfam:HATPase_c_3 26 92 1.2e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000202261
AA Change: H319Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144369
Gene: ENSMUSG00000039456
AA Change: H319Q

Pfam:HATPase_c 25 130 8e-8 PFAM
Pfam:HATPase_c_3 26 164 1.1e-18 PFAM
Pfam:zf-CW 409 452 2.7e-19 PFAM
low complexity region 461 472 N/A INTRINSIC
low complexity region 630 639 N/A INTRINSIC
coiled coil region 765 871 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202663
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231891
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232425
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that localizes to the nuclear matrix and forms nuclear bodies via an ATP-dependent mechanism. The protein is predicted to have coiled-coil and zinc finger domains and has RNA binding activity. Alternative splicing produces multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a null allele die at or within a day of birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600014C23Rik C T 17: 45,733,073 W86* probably null Het
5830411N06Rik A G 7: 140,247,959 N27D probably benign Het
Acadl T C 1: 66,857,408 H75R probably benign Het
Adamtsl1 T C 4: 86,277,143 F599S probably damaging Het
Adrb3 T C 8: 27,228,265 N52S probably damaging Het
Agbl3 T A 6: 34,799,705 L377Q probably damaging Het
Akap9 T C 5: 4,060,318 L3007P probably damaging Het
Amer3 T A 1: 34,587,821 Y380* probably null Het
Ankrd13d A T 19: 4,273,019 probably null Het
Ap4m1 T A 5: 138,176,239 C235S probably benign Het
Arhgap29 T C 3: 122,007,641 F675S probably damaging Het
Asah2 C A 19: 32,008,639 V544F probably damaging Het
Ash2l A G 8: 25,823,291 I389T possibly damaging Het
Bend5 T C 4: 111,433,298 S164P probably benign Het
Cacna1d A G 14: 30,171,294 probably null Het
Cdc25b A G 2: 131,197,262 N516D probably benign Het
Cdc27 A G 11: 104,531,734 Y125H probably damaging Het
Cdk5r2 C T 1: 74,855,836 L247F probably damaging Het
Cenpf C A 1: 189,658,062 G1191V probably benign Het
Cops4 C T 5: 100,537,460 T293I possibly damaging Het
Csmd3 A G 15: 47,913,940 L1294P probably damaging Het
Dclre1a T C 19: 56,538,440 Y848C probably damaging Het
Disp2 A T 2: 118,790,844 I686F possibly damaging Het
Dnah6 T A 6: 73,022,412 Y4012F probably benign Het
Dnajc11 C G 4: 151,969,936 R200G probably damaging Het
Dnhd1 A T 7: 105,696,464 D2272V possibly damaging Het
Elane A C 10: 79,886,349 R5S possibly damaging Het
Entpd7 G A 19: 43,691,094 V29M probably benign Het
Fanca A G 8: 123,289,359 probably null Het
Fgl1 G T 8: 41,191,624 T281K probably benign Het
Flii T C 11: 60,722,997 probably null Het
Foxn1 T C 11: 78,371,144 D133G possibly damaging Het
Fzd7 T A 1: 59,484,560 M534K probably damaging Het
Galnt5 A G 2: 57,999,395 T336A probably benign Het
Gli3 G A 13: 15,724,715 D896N probably damaging Het
Gsx1 G T 5: 147,189,946 W193L probably damaging Het
Gtpbp3 A T 8: 71,492,735 I485F probably damaging Het
H2-M11 A G 17: 36,547,391 T26A probably benign Het
Igfbp7 T C 5: 77,351,980 D243G probably damaging Het
Il31ra A T 13: 112,525,843 D477E possibly damaging Het
Inmt A C 6: 55,171,227 V139G probably damaging Het
Inpp5j T A 11: 3,501,147 M501L probably benign Het
Itsn2 T C 12: 4,712,556 F1579L probably damaging Het
Kat2b C A 17: 53,567,538 A70E probably benign Het
Klhl20 T C 1: 161,093,711 E58G probably damaging Het
Krt79 A T 15: 101,931,548 Y337* probably null Het
Krt81 C A 15: 101,463,627 R24L possibly damaging Het
Letm1 T C 5: 33,769,426 I176V possibly damaging Het
Lingo3 C A 10: 80,835,784 R104L probably benign Het
Lrig3 T G 10: 126,010,221 C840G probably damaging Het
Lrrc9 A G 12: 72,486,288 N977S probably damaging Het
Lrrk2 T A 15: 91,772,996 M1831K probably benign Het
Mn1 A T 5: 111,419,316 D384V probably damaging Het
Morn1 T C 4: 155,089,503 F56L possibly damaging Het
Mrpl53 G T 6: 83,109,411 V64L probably damaging Het
Myo15 T A 11: 60,479,336 V974D probably benign Het
Neb A G 2: 52,256,124 V2947A possibly damaging Het
Nfasc A C 1: 132,603,816 N737K probably damaging Het
Nlk T C 11: 78,572,277 D464G possibly damaging Het
Nlrc4 C T 17: 74,426,963 R985K probably benign Het
Nsun6 T C 2: 14,996,336 K470E probably benign Het
Nup85 T G 11: 115,564,531 M1R probably null Het
Olfr887 G A 9: 38,085,370 C178Y probably damaging Het
Otop1 T C 5: 38,287,948 V150A possibly damaging Het
Pclo C T 5: 14,681,749 R296* probably null Het
Pdzd2 A T 15: 12,458,058 C240S possibly damaging Het
Plekhg5 A G 4: 152,114,120 T922A probably benign Het
Plekhm2 A C 4: 141,642,070 L101R probably damaging Het
Plscr3 T A 11: 69,847,994 C161S probably benign Het
Prr14l C T 5: 32,828,915 D1079N probably benign Het
Ptpru A T 4: 131,771,179 V1377E possibly damaging Het
Rab37 C A 11: 115,158,702 D112E probably benign Het
Raet1e T A 10: 22,174,375 I19N probably damaging Het
Rassf5 T C 1: 131,245,066 Y22C probably damaging Het
Rp1 T C 1: 4,346,498 T1464A probably benign Het
Safb T A 17: 56,601,092 probably benign Het
Scarf2 A G 16: 17,806,505 probably null Het
Sh3d19 T C 3: 86,106,973 S415P probably benign Het
Slc26a9 T A 1: 131,763,804 L595Q probably damaging Het
Slc4a8 T C 15: 100,796,550 Y470H probably damaging Het
Slitrk3 T C 3: 73,049,649 N597D probably benign Het
Spata31 T A 13: 64,922,213 V725E probably benign Het
Spink12 T A 18: 44,107,764 C72* probably null Het
Spink5 T A 18: 44,012,975 probably null Het
Stk40 C A 4: 126,118,332 S9* probably null Het
Sypl A T 12: 32,965,421 T40S probably damaging Het
Tbc1d8 C T 1: 39,391,209 E438K probably benign Het
Tdrd7 A G 4: 45,989,102 T111A probably benign Het
Tg A T 15: 66,741,484 probably null Het
Tlr5 T A 1: 182,973,889 W253R probably damaging Het
Tmprss11c C T 5: 86,235,469 C353Y probably damaging Het
Tnfrsf8 T A 4: 145,288,027 M271L probably benign Het
Toe1 T C 4: 116,806,750 N21S probably benign Het
Tpp2 T C 1: 43,975,447 F649L probably benign Het
Ttll1 G A 15: 83,502,225 Q60* probably null Het
Vcp C T 4: 42,982,565 R709Q probably benign Het
Vmn1r119 T A 7: 21,011,668 H263L possibly damaging Het
Vmn1r195 C A 13: 22,278,941 Q194K probably damaging Het
Vmn1r33 T C 6: 66,611,799 Y257C probably damaging Het
Vmn2r15 A G 5: 109,293,015 F326L probably benign Het
Wbp11 A T 6: 136,816,110 probably benign Het
Wwp2 T G 8: 107,517,946 V250G probably benign Het
Xpnpep3 T C 15: 81,430,837 V246A probably benign Het
Zcchc14 G A 8: 121,605,449 R419* probably null Het
Other mutations in Morc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00561:Morc3 APN 16 93873395 critical splice donor site probably null
IGL01015:Morc3 APN 16 93862646 missense probably damaging 1.00
IGL01374:Morc3 APN 16 93844213 missense probably damaging 1.00
IGL01634:Morc3 APN 16 93873237 missense probably benign 0.02
IGL01845:Morc3 APN 16 93860567 missense probably damaging 0.96
IGL02202:Morc3 APN 16 93870861 missense probably benign 0.01
IGL02478:Morc3 APN 16 93864956 splice site probably benign
IGL03026:Morc3 APN 16 93862724 splice site probably benign
IGL03115:Morc3 APN 16 93871083 missense probably damaging 0.99
Ballista UTSW 16 93841383 missense probably damaging 1.00
mindy UTSW 16 93866533 missense probably benign 0.03
pfaff UTSW 16 93862684 missense probably damaging 0.96
shield UTSW 16 93874812 missense probably damaging 0.98
sparkle UTSW 16 93870474 missense probably damaging 1.00
Stooges UTSW 16 93841387 missense probably damaging 1.00
Sword UTSW 16 93874757 critical splice acceptor site probably null
R0173:Morc3 UTSW 16 93832206 splice site probably null
R0413:Morc3 UTSW 16 93870474 missense probably damaging 1.00
R0842:Morc3 UTSW 16 93873396 critical splice donor site probably null
R1134:Morc3 UTSW 16 93870669 missense probably benign
R1162:Morc3 UTSW 16 93853108 missense probably damaging 1.00
R1498:Morc3 UTSW 16 93853855 missense probably damaging 1.00
R1520:Morc3 UTSW 16 93844241 missense probably damaging 0.96
R1603:Morc3 UTSW 16 93866503 missense probably benign
R1622:Morc3 UTSW 16 93874806 missense probably benign 0.28
R1630:Morc3 UTSW 16 93866533 missense probably benign 0.03
R1818:Morc3 UTSW 16 93855510 missense probably damaging 1.00
R1902:Morc3 UTSW 16 93870497 missense probably damaging 1.00
R2090:Morc3 UTSW 16 93866453 missense probably benign 0.23
R2261:Morc3 UTSW 16 93853221 splice site probably benign
R2360:Morc3 UTSW 16 93841387 missense probably damaging 1.00
R2407:Morc3 UTSW 16 93844327 critical splice donor site probably null
R2519:Morc3 UTSW 16 93862539 splice site probably null
R3736:Morc3 UTSW 16 93874812 missense probably damaging 0.98
R3873:Morc3 UTSW 16 93862436 missense probably damaging 0.99
R4114:Morc3 UTSW 16 93873339 missense probably benign 0.01
R4115:Morc3 UTSW 16 93873339 missense probably benign 0.01
R4116:Morc3 UTSW 16 93873339 missense probably benign 0.01
R4472:Morc3 UTSW 16 93874757 critical splice acceptor site probably null
R4609:Morc3 UTSW 16 93864968 missense probably benign 0.01
R4708:Morc3 UTSW 16 93873238 missense probably benign 0.19
R4883:Morc3 UTSW 16 93870362 critical splice acceptor site probably null
R4945:Morc3 UTSW 16 93871194 missense probably damaging 1.00
R4965:Morc3 UTSW 16 93860587 nonsense probably null
R5399:Morc3 UTSW 16 93862539 splice site probably null
R5481:Morc3 UTSW 16 93862655 missense probably damaging 0.99
R5540:Morc3 UTSW 16 93847380 missense probably benign
R5970:Morc3 UTSW 16 93866453 missense possibly damaging 0.65
R6006:Morc3 UTSW 16 93866493 missense possibly damaging 0.67
R6044:Morc3 UTSW 16 93866442 missense probably benign 0.02
R6045:Morc3 UTSW 16 93874845 missense probably damaging 1.00
R6155:Morc3 UTSW 16 93862425 missense possibly damaging 0.94
R6165:Morc3 UTSW 16 93841383 missense probably damaging 1.00
R6225:Morc3 UTSW 16 93845194 nonsense probably null
R6240:Morc3 UTSW 16 93862684 missense probably damaging 0.96
R6835:Morc3 UTSW 16 93847421 missense probably damaging 1.00
R6918:Morc3 UTSW 16 93853135 missense probably benign 0.36
R6944:Morc3 UTSW 16 93870572 missense probably benign
R7311:Morc3 UTSW 16 93849173 missense probably damaging 1.00
R7398:Morc3 UTSW 16 93874860 missense probably damaging 1.00
R7553:Morc3 UTSW 16 93870936 missense probably damaging 0.98
R8056:Morc3 UTSW 16 93845176 missense probably benign 0.07
R8299:Morc3 UTSW 16 93853200 missense probably damaging 1.00
R8317:Morc3 UTSW 16 93862529 missense probably benign 0.25
R8542:Morc3 UTSW 16 93847431 critical splice donor site probably null
R8697:Morc3 UTSW 16 93871020 missense probably benign 0.00
R8739:Morc3 UTSW 16 93860510 missense probably damaging 1.00
X0023:Morc3 UTSW 16 93847399 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- acatagtgaatcccagcagag -3'
Posted On2013-07-11