Incidental Mutation 'R7339:Abcb11'
ID569680
Institutional Source Beutler Lab
Gene Symbol Abcb11
Ensembl Gene ENSMUSG00000027048
Gene NameATP-binding cassette, sub-family B (MDR/TAP), member 11
SynonymsPFIC2, Bsep, PGY4, Lith1, ABC16, sister of P-glycoprotein
MMRRC Submission
Accession Numbers

Genbank: NM_021022; MGI: 1351619

Is this an essential gene? Possibly non essential (E-score: 0.435) question?
Stock #R7339 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location69238282-69342616 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 69299867 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 282 (D282N)
Ref Sequence ENSEMBL: ENSMUSP00000099771 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102709] [ENSMUST00000102710] [ENSMUST00000180142]
Predicted Effect probably damaging
Transcript: ENSMUST00000102709
AA Change: D282N

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000099770
Gene: ENSMUSG00000027048
AA Change: D282N

DomainStartEndE-ValueType
Pfam:ABC_membrane 62 373 1.3e-65 PFAM
AAA 447 639 1.65e-17 SMART
Pfam:ABC_membrane 755 1031 2.7e-55 PFAM
AAA 1105 1299 1.9e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000102710
AA Change: D282N

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000099771
Gene: ENSMUSG00000027048
AA Change: D282N

DomainStartEndE-ValueType
Pfam:ABC_membrane 62 371 1.7e-72 PFAM
AAA 447 639 1.65e-17 SMART
Pfam:ABC_membrane 755 1029 3.2e-59 PFAM
AAA 1105 1299 1.9e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000180142
AA Change: D282N

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000137017
Gene: ENSMUSG00000027048
AA Change: D282N

DomainStartEndE-ValueType
Pfam:ABC_membrane 62 371 1.4e-72 PFAM
AAA 447 639 1.65e-17 SMART
Pfam:ABC_membrane 755 1029 2.5e-59 PFAM
AAA 1105 1299 1.9e-17 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MDR/TAP subfamily. Members of the MDR/TAP subfamily are involved in multidrug resistance. The protein encoded by this gene is the major canalicular bile salt transporter in humans and mice. Mutations in the human gene cause a form of progressive familial intrahepatic cholestases which are a group of inherited disorders with severe cholestatic liver disease from early infancy. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene display intrahepatic cholestasis. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, knock-out(1) Targeted, other(2)

Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik G A 11: 78,272,384 probably null Het
2900026A02Rik T C 5: 113,183,072 D1092G probably benign Het
9030624J02Rik A T 7: 118,809,971 I612F probably damaging Het
Ahnak A T 19: 9,008,165 N2271I possibly damaging Het
Amz1 A G 5: 140,741,551 S90G probably benign Het
Arhgap5 A G 12: 52,517,698 E484G possibly damaging Het
Arid3c A G 4: 41,729,883 probably null Het
Atp1a1 T C 3: 101,589,872 I373V probably benign Het
Barhl1 T C 2: 28,909,887 E242G probably damaging Het
Cactin CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG 10: 81,321,318 probably benign Het
Casz1 T A 4: 148,951,745 V1488E probably damaging Het
Ccdc175 C A 12: 72,136,041 Q401H probably damaging Het
Cfap36 T C 11: 29,225,925 Y191C probably benign Het
Chmp2b G A 16: 65,545,346 Q119* probably null Het
Cps1 T A 1: 67,197,015 I969N possibly damaging Het
Dennd5a A G 7: 109,901,159 F920L probably damaging Het
Dnah12 A T 14: 26,872,320 T3410S probably benign Het
Fbxo42 T G 4: 141,200,144 S578R possibly damaging Het
Fcgr1 C T 3: 96,284,299 G398R not run Het
Foxa3 A T 7: 19,014,869 Y111N probably damaging Het
Gabbr2 T C 4: 46,846,340 K190E probably benign Het
Gbp10 T C 5: 105,220,098 Y403C possibly damaging Het
Gm906 A T 13: 50,247,168 I374N possibly damaging Het
Hsd3b5 A G 3: 98,622,074 I80T probably damaging Het
Kri1 T G 9: 21,286,587 Q89P Het
Lrp6 G T 6: 134,450,818 P1604T probably damaging Het
Metap1 T C 3: 138,466,137 probably null Het
Mkrn3 C T 7: 62,419,782 R87H probably benign Het
Ms4a6d G A 19: 11,590,073 Q155* probably null Het
Myh6 T C 14: 54,961,568 probably null Het
Naip6 G T 13: 100,316,019 P178Q probably damaging Het
Ncapg2 A G 12: 116,414,834 E160G probably damaging Het
Nek6 G A 2: 38,560,965 A127T probably damaging Het
Nell1 T C 7: 50,279,549 V264A probably benign Het
Nlrp2 T A 7: 5,327,628 I590F possibly damaging Het
Olfr1308 A T 2: 111,960,611 M154K probably benign Het
Olfr1310 A G 2: 112,008,475 L237P probably damaging Het
Olfr1390 G A 11: 49,341,048 R172Q not run Het
Olfr503 A C 7: 108,544,900 D125A probably damaging Het
Olfr71 C T 4: 43,706,080 A163T probably benign Het
Otop3 T A 11: 115,346,378 L556Q probably damaging Het
Padi1 T C 4: 140,829,234 D190G probably null Het
Pald1 T C 10: 61,323,331 S774G possibly damaging Het
Pde10a C T 17: 8,757,028 T55I probably benign Het
Pla2g4d T C 2: 120,278,978 M197V probably benign Het
Prom1 C A 5: 44,101,653 probably benign Het
Ptdss1 A G 13: 66,963,362 H164R possibly damaging Het
Rrh A T 3: 129,810,613 I313N probably damaging Het
Slc35b4 A G 6: 34,167,656 I88T probably damaging Het
Slc38a11 C T 2: 65,326,570 V353I probably benign Het
Spdef T A 17: 27,720,245 E42D probably benign Het
Tgoln1 G C 6: 72,616,278 T73R probably benign Het
Tmx1 A G 12: 70,458,850 D129G probably benign Het
Trav13n-4 A T 14: 53,363,978 Y68F probably benign Het
Trp53 T C 11: 69,589,189 S238P probably damaging Het
Trp53bp1 T C 2: 121,236,469 D592G probably benign Het
Ttll5 T C 12: 85,857,464 probably null Het
Urb1 CACTTAC CAC 16: 90,772,573 probably benign Het
Vmn2r43 A T 7: 8,255,307 Y302* probably null Het
Vps13d C T 4: 145,121,368 V2478I Het
Wsb1 A G 11: 79,240,358 V404A probably damaging Het
Zfc3h1 A G 10: 115,403,300 D539G probably damaging Het
Zfp318 T C 17: 46,411,247 V1392A probably damaging Het
Other mutations in Abcb11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00544:Abcb11 APN 2 69284681 missense possibly damaging 0.90
IGL01407:Abcb11 APN 2 69245944 missense probably damaging 1.00
IGL01583:Abcb11 APN 2 69296409 missense possibly damaging 0.81
IGL01813:Abcb11 APN 2 69287592 splice site probably benign
IGL01885:Abcb11 APN 2 69287627 missense probably damaging 1.00
IGL01937:Abcb11 APN 2 69287612 missense probably damaging 1.00
IGL02058:Abcb11 APN 2 69243498 missense probably damaging 0.98
IGL02117:Abcb11 APN 2 69323825 splice site probably benign
IGL02119:Abcb11 APN 2 69328000 critical splice acceptor site probably null
IGL02120:Abcb11 APN 2 69257310 missense probably damaging 1.00
IGL02158:Abcb11 APN 2 69299925 missense probably damaging 0.96
IGL02212:Abcb11 APN 2 69248889 missense probably damaging 0.97
IGL02306:Abcb11 APN 2 69265457 nonsense probably null
IGL02505:Abcb11 APN 2 69245761 missense probably damaging 1.00
IGL02538:Abcb11 APN 2 69306605 missense possibly damaging 0.67
IGL02793:Abcb11 APN 2 69291949 missense possibly damaging 0.90
IGL02863:Abcb11 APN 2 69284682 missense probably damaging 0.99
IGL02875:Abcb11 APN 2 69291949 missense possibly damaging 0.90
IGL03164:Abcb11 APN 2 69291999 nonsense probably null
IGL03181:Abcb11 APN 2 69328008 intron probably benign
3-1:Abcb11 UTSW 2 69327993 missense probably benign 0.00
FR4737:Abcb11 UTSW 2 69243518 missense probably damaging 0.97
R0031:Abcb11 UTSW 2 69285308 missense probably damaging 1.00
R0398:Abcb11 UTSW 2 69286666 missense probably null 0.82
R0413:Abcb11 UTSW 2 69328011 intron probably benign
R0437:Abcb11 UTSW 2 69257295 missense probably damaging 1.00
R0496:Abcb11 UTSW 2 69277884 splice site probably benign
R0646:Abcb11 UTSW 2 69285283 missense probably damaging 1.00
R0669:Abcb11 UTSW 2 69329318 missense probably benign 0.15
R0856:Abcb11 UTSW 2 69323918 missense probably benign
R1061:Abcb11 UTSW 2 69277809 missense probably benign 0.00
R1460:Abcb11 UTSW 2 69257374 splice site probably benign
R1714:Abcb11 UTSW 2 69306581 missense probably damaging 0.99
R1739:Abcb11 UTSW 2 69261566 missense probably damaging 1.00
R1856:Abcb11 UTSW 2 69245923 missense probably damaging 1.00
R1994:Abcb11 UTSW 2 69282670 splice site probably null
R2086:Abcb11 UTSW 2 69259476 splice site probably benign
R2133:Abcb11 UTSW 2 69323883 missense possibly damaging 0.65
R2516:Abcb11 UTSW 2 69329329 missense possibly damaging 0.88
R2930:Abcb11 UTSW 2 69257358 missense probably damaging 0.96
R3771:Abcb11 UTSW 2 69329376 splice site probably benign
R3772:Abcb11 UTSW 2 69329376 splice site probably benign
R3979:Abcb11 UTSW 2 69323976 missense probably benign 0.11
R4227:Abcb11 UTSW 2 69284776 missense probably damaging 1.00
R4255:Abcb11 UTSW 2 69306605 missense probably benign 0.03
R4614:Abcb11 UTSW 2 69284681 missense possibly damaging 0.90
R4647:Abcb11 UTSW 2 69285271 missense probably damaging 1.00
R4719:Abcb11 UTSW 2 69259627 missense probably damaging 1.00
R4734:Abcb11 UTSW 2 69323962 missense possibly damaging 0.73
R4765:Abcb11 UTSW 2 69245867 missense probably damaging 1.00
R4861:Abcb11 UTSW 2 69245905 missense probably damaging 1.00
R4861:Abcb11 UTSW 2 69245905 missense probably damaging 1.00
R4870:Abcb11 UTSW 2 69239196 missense probably damaging 0.99
R4988:Abcb11 UTSW 2 69323892 missense probably benign 0.12
R5028:Abcb11 UTSW 2 69274012 missense probably damaging 1.00
R5048:Abcb11 UTSW 2 69308506 missense probably benign 0.06
R5177:Abcb11 UTSW 2 69285295 missense probably damaging 1.00
R5301:Abcb11 UTSW 2 69286847 missense probably damaging 0.98
R5789:Abcb11 UTSW 2 69245764 missense probably damaging 1.00
R5892:Abcb11 UTSW 2 69261500 missense probably damaging 0.99
R6003:Abcb11 UTSW 2 69243467 missense probably benign 0.43
R6252:Abcb11 UTSW 2 69291961 missense probably benign 0.10
R6389:Abcb11 UTSW 2 69323894 missense probably damaging 1.00
R6512:Abcb11 UTSW 2 69282652 missense probably benign
R6590:Abcb11 UTSW 2 69284718 missense probably damaging 1.00
R6690:Abcb11 UTSW 2 69284718 missense probably damaging 1.00
R6732:Abcb11 UTSW 2 69286846 missense probably damaging 1.00
R6870:Abcb11 UTSW 2 69285298 missense possibly damaging 0.91
R7028:Abcb11 UTSW 2 69265675 missense probably benign
R7223:Abcb11 UTSW 2 69274143 missense probably benign
R7323:Abcb11 UTSW 2 69287635 missense probably damaging 1.00
R7337:Abcb11 UTSW 2 69245769 missense probably damaging 1.00
R7340:Abcb11 UTSW 2 69299867 missense probably damaging 0.99
R7341:Abcb11 UTSW 2 69299867 missense probably damaging 0.99
R7343:Abcb11 UTSW 2 69299867 missense probably damaging 0.99
R7366:Abcb11 UTSW 2 69299867 missense probably damaging 0.99
R7393:Abcb11 UTSW 2 69299867 missense probably damaging 0.99
R7394:Abcb11 UTSW 2 69299867 missense probably damaging 0.99
R7405:Abcb11 UTSW 2 69287619 missense probably damaging 1.00
R7411:Abcb11 UTSW 2 69303936 critical splice donor site probably null
R7488:Abcb11 UTSW 2 69277802 missense probably benign
R7544:Abcb11 UTSW 2 69265486 missense probably benign 0.05
R7660:Abcb11 UTSW 2 69287594 splice site probably null
R7754:Abcb11 UTSW 2 69286818 missense probably damaging 1.00
R7771:Abcb11 UTSW 2 69239191 missense probably damaging 0.99
R7794:Abcb11 UTSW 2 69286678 missense possibly damaging 0.62
R7834:Abcb11 UTSW 2 69284724 missense probably damaging 1.00
R7836:Abcb11 UTSW 2 69323873 small deletion probably benign
R7842:Abcb11 UTSW 2 69323873 small deletion probably benign
R7894:Abcb11 UTSW 2 69323873 small deletion probably benign
R7896:Abcb11 UTSW 2 69323873 small deletion probably benign
R7897:Abcb11 UTSW 2 69323872 frame shift probably null
R7897:Abcb11 UTSW 2 69323873 small deletion probably benign
R7898:Abcb11 UTSW 2 69323873 small deletion probably benign
R7917:Abcb11 UTSW 2 69284724 missense probably damaging 1.00
R8004:Abcb11 UTSW 2 69257210 missense possibly damaging 0.68
X0058:Abcb11 UTSW 2 69289443 missense probably benign 0.12
X0062:Abcb11 UTSW 2 69245906 missense probably damaging 1.00
X0065:Abcb11 UTSW 2 69299866 missense probably damaging 0.99
Z1176:Abcb11 UTSW 2 69291981 missense probably damaging 1.00
Z1177:Abcb11 UTSW 2 69306529 missense probably damaging 1.00
Z1177:Abcb11 UTSW 2 69329269 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGCCCATCAACATTTGCCAAT -3'
(R):5'- CACCCATCTTGAACCAGCTT -3'

Sequencing Primer
(F):5'- CCTGTTGCTCTAAATGACAGTGGATC -3'
(R):5'- ACCCATCTTGAACCAGCTTTTTCTC -3'
Posted On2019-09-13