Incidental Mutation 'R7339:Trp53bp1'
ID 569684
Institutional Source Beutler Lab
Gene Symbol Trp53bp1
Ensembl Gene ENSMUSG00000043909
Gene Name transformation related protein 53 binding protein 1
Synonyms 53BP1, p53BP1
MMRRC Submission 045429-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7339 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 121023762-121101888 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 121066950 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 592 (D592G)
Ref Sequence ENSEMBL: ENSMUSP00000106277 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110647] [ENSMUST00000110648] [ENSMUST00000129752] [ENSMUST00000131245]
AlphaFold P70399
Predicted Effect probably benign
Transcript: ENSMUST00000110647
AA Change: D592G

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000106277
Gene: ENSMUSG00000043909
AA Change: D592G

DomainStartEndE-ValueType
low complexity region 136 149 N/A INTRINSIC
low complexity region 158 169 N/A INTRINSIC
low complexity region 647 661 N/A INTRINSIC
low complexity region 1031 1042 N/A INTRINSIC
low complexity region 1099 1112 N/A INTRINSIC
low complexity region 1260 1272 N/A INTRINSIC
low complexity region 1290 1332 N/A INTRINSIC
Pfam:53-BP1_Tudor 1430 1551 2.5e-80 PFAM
low complexity region 1581 1601 N/A INTRINSIC
BRCT 1673 1785 7.13e-1 SMART
BRCT 1813 1901 1.03e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110648
AA Change: D592G

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000106278
Gene: ENSMUSG00000043909
AA Change: D592G

DomainStartEndE-ValueType
low complexity region 136 149 N/A INTRINSIC
low complexity region 158 169 N/A INTRINSIC
low complexity region 647 661 N/A INTRINSIC
low complexity region 1031 1042 N/A INTRINSIC
low complexity region 1099 1112 N/A INTRINSIC
low complexity region 1260 1272 N/A INTRINSIC
low complexity region 1290 1332 N/A INTRINSIC
low complexity region 1389 1409 N/A INTRINSIC
Pfam:53-BP1_Tudor 1480 1601 1.5e-80 PFAM
low complexity region 1631 1651 N/A INTRINSIC
BRCT 1723 1835 7.13e-1 SMART
BRCT 1863 1951 1.03e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129752
Predicted Effect probably benign
Transcript: ENSMUST00000131245
AA Change: D592G

PolyPhen 2 Score 0.204 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000114457
Gene: ENSMUSG00000043909
AA Change: D592G

DomainStartEndE-ValueType
low complexity region 136 149 N/A INTRINSIC
low complexity region 158 169 N/A INTRINSIC
low complexity region 647 661 N/A INTRINSIC
low complexity region 991 1002 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142400
Predicted Effect probably benign
Transcript: ENSMUST00000147540
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (61/61)
MGI Phenotype PHENOTYPE: Homozygous mutations in this gene result in growth retardation, immunodeficiency, thymic hypoplasia, and increased incidence of thymic lymphomas. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik T C 5: 113,330,938 (GRCm39) D1092G probably benign Het
Abcb11 C T 2: 69,130,211 (GRCm39) D282N probably damaging Het
Ahnak A T 19: 8,985,529 (GRCm39) N2271I possibly damaging Het
Amz1 A G 5: 140,727,306 (GRCm39) S90G probably benign Het
Arhgap5 A G 12: 52,564,481 (GRCm39) E484G possibly damaging Het
Arid3c A G 4: 41,729,883 (GRCm39) probably null Het
Atp1a1 T C 3: 101,497,188 (GRCm39) I373V probably benign Het
Barhl1 T C 2: 28,799,899 (GRCm39) E242G probably damaging Het
Bltp2 G A 11: 78,163,210 (GRCm39) probably null Het
Cactin CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG 10: 81,157,152 (GRCm39) probably benign Het
Casz1 T A 4: 149,036,202 (GRCm39) V1488E probably damaging Het
Ccdc175 C A 12: 72,182,815 (GRCm39) Q401H probably damaging Het
Cfap36 T C 11: 29,175,925 (GRCm39) Y191C probably benign Het
Chmp2b G A 16: 65,342,232 (GRCm39) Q119* probably null Het
Cps1 T A 1: 67,236,174 (GRCm39) I969N possibly damaging Het
Dennd5a A G 7: 109,500,366 (GRCm39) F920L probably damaging Het
Dnah12 A T 14: 26,594,277 (GRCm39) T3410S probably benign Het
Fbxo42 T G 4: 140,927,455 (GRCm39) S578R possibly damaging Het
Fcgr1 C T 3: 96,191,615 (GRCm39) G398R not run Het
Foxa3 A T 7: 18,748,794 (GRCm39) Y111N probably damaging Het
Gabbr2 T C 4: 46,846,340 (GRCm39) K190E probably benign Het
Gbp10 T C 5: 105,367,964 (GRCm39) Y403C possibly damaging Het
Hsd3b5 A G 3: 98,529,390 (GRCm39) I80T probably damaging Het
Kri1 T G 9: 21,197,883 (GRCm39) Q89P Het
Lrp6 G T 6: 134,427,781 (GRCm39) P1604T probably damaging Het
Metap1 T C 3: 138,171,898 (GRCm39) probably null Het
Mkrn3 C T 7: 62,069,530 (GRCm39) R87H probably benign Het
Ms4a6d G A 19: 11,567,437 (GRCm39) Q155* probably null Het
Myh6 T C 14: 55,199,025 (GRCm39) probably null Het
Naip6 G T 13: 100,452,527 (GRCm39) P178Q probably damaging Het
Ncapg2 A G 12: 116,378,454 (GRCm39) E160G probably damaging Het
Nek6 G A 2: 38,450,977 (GRCm39) A127T probably damaging Het
Nell1 T C 7: 49,929,297 (GRCm39) V264A probably benign Het
Nlrp2 T A 7: 5,330,627 (GRCm39) I590F possibly damaging Het
Or13j1 C T 4: 43,706,080 (GRCm39) A163T probably benign Het
Or2y17 G A 11: 49,231,875 (GRCm39) R172Q not run Het
Or4f57 A T 2: 111,790,956 (GRCm39) M154K probably benign Het
Or4f6 A G 2: 111,838,820 (GRCm39) L237P probably damaging Het
Or52n4b A C 7: 108,144,107 (GRCm39) D125A probably damaging Het
Otop3 T A 11: 115,237,204 (GRCm39) L556Q probably damaging Het
Padi1 T C 4: 140,556,545 (GRCm39) D190G probably null Het
Pald1 T C 10: 61,159,110 (GRCm39) S774G possibly damaging Het
Pde10a C T 17: 8,975,860 (GRCm39) T55I probably benign Het
Pla2g4d T C 2: 120,109,459 (GRCm39) M197V probably benign Het
Prom1 C A 5: 44,258,995 (GRCm39) probably benign Het
Ptdss1 A G 13: 67,111,426 (GRCm39) H164R possibly damaging Het
Rrh A T 3: 129,604,262 (GRCm39) I313N probably damaging Het
Slc35b4 A G 6: 34,144,591 (GRCm39) I88T probably damaging Het
Slc38a11 C T 2: 65,156,914 (GRCm39) V353I probably benign Het
Spata31e3 A T 13: 50,401,204 (GRCm39) I374N possibly damaging Het
Spdef T A 17: 27,939,219 (GRCm39) E42D probably benign Het
Tgoln1 G C 6: 72,593,261 (GRCm39) T73R probably benign Het
Tmx1 A G 12: 70,505,624 (GRCm39) D129G probably benign Het
Trav13n-4 A T 14: 53,601,435 (GRCm39) Y68F probably benign Het
Trp53 T C 11: 69,480,015 (GRCm39) S238P probably damaging Het
Ttll5 T C 12: 85,904,238 (GRCm39) probably null Het
Urb1 CACTTAC CAC 16: 90,569,461 (GRCm39) probably benign Het
Vmn2r43 A T 7: 8,258,306 (GRCm39) Y302* probably null Het
Vps13d C T 4: 144,847,938 (GRCm39) V2478I Het
Vps35l A T 7: 118,409,194 (GRCm39) I612F probably damaging Het
Wsb1 A G 11: 79,131,184 (GRCm39) V404A probably damaging Het
Zfc3h1 A G 10: 115,239,205 (GRCm39) D539G probably damaging Het
Zfp318 T C 17: 46,722,173 (GRCm39) V1392A probably damaging Het
Other mutations in Trp53bp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Trp53bp1 APN 2 121,087,060 (GRCm39) missense possibly damaging 0.69
IGL00690:Trp53bp1 APN 2 121,066,476 (GRCm39) missense probably damaging 1.00
IGL00922:Trp53bp1 APN 2 121,038,963 (GRCm39) missense probably damaging 0.96
IGL01475:Trp53bp1 APN 2 121,100,800 (GRCm39) splice site probably null
IGL01639:Trp53bp1 APN 2 121,033,173 (GRCm39) missense possibly damaging 0.51
IGL01662:Trp53bp1 APN 2 121,066,506 (GRCm39) missense probably damaging 1.00
IGL01757:Trp53bp1 APN 2 121,041,785 (GRCm39) missense probably damaging 0.99
IGL01829:Trp53bp1 APN 2 121,046,377 (GRCm39) missense probably benign 0.39
IGL02247:Trp53bp1 APN 2 121,067,070 (GRCm39) missense probably damaging 1.00
IGL02349:Trp53bp1 APN 2 121,029,555 (GRCm39) missense probably damaging 1.00
IGL02391:Trp53bp1 APN 2 121,033,191 (GRCm39) missense possibly damaging 0.67
chives UTSW 2 121,082,349 (GRCm39) missense probably null 0.13
concur UTSW 2 121,100,800 (GRCm39) splice site probably null
confirmation UTSW 2 121,035,594 (GRCm39) critical splice acceptor site probably null
Infra UTSW 2 121,077,980 (GRCm39) critical splice donor site probably null
Legume UTSW 2 121,029,523 (GRCm39) missense probably damaging 0.99
lentil UTSW 2 121,082,349 (GRCm39) missense probably null 0.13
lentil2 UTSW 2 121,038,368 (GRCm39) missense probably damaging 1.00
Profundus UTSW 2 121,038,284 (GRCm39) missense probably damaging 1.00
split_pea UTSW 2 121,059,087 (GRCm39) nonsense probably null
verily UTSW 2 121,041,794 (GRCm39) missense probably damaging 1.00
PIT1430001:Trp53bp1 UTSW 2 121,101,756 (GRCm39) missense probably damaging 1.00
R0045:Trp53bp1 UTSW 2 121,034,978 (GRCm39) missense probably benign
R0060:Trp53bp1 UTSW 2 121,035,006 (GRCm39) missense probably damaging 1.00
R0060:Trp53bp1 UTSW 2 121,035,006 (GRCm39) missense probably damaging 1.00
R0103:Trp53bp1 UTSW 2 121,067,240 (GRCm39) missense possibly damaging 0.92
R0103:Trp53bp1 UTSW 2 121,067,240 (GRCm39) missense possibly damaging 0.92
R0281:Trp53bp1 UTSW 2 121,100,718 (GRCm39) missense probably damaging 1.00
R0386:Trp53bp1 UTSW 2 121,035,424 (GRCm39) missense probably damaging 1.00
R0427:Trp53bp1 UTSW 2 121,066,498 (GRCm39) missense probably damaging 1.00
R0505:Trp53bp1 UTSW 2 121,100,450 (GRCm39) missense probably damaging 0.99
R0522:Trp53bp1 UTSW 2 121,082,349 (GRCm39) missense probably null 0.13
R0523:Trp53bp1 UTSW 2 121,082,349 (GRCm39) missense probably null 0.13
R0525:Trp53bp1 UTSW 2 121,082,349 (GRCm39) missense probably null 0.13
R0543:Trp53bp1 UTSW 2 121,082,349 (GRCm39) missense probably null 0.13
R0559:Trp53bp1 UTSW 2 121,058,282 (GRCm39) missense probably damaging 1.00
R0573:Trp53bp1 UTSW 2 121,058,653 (GRCm39) splice site probably benign
R0593:Trp53bp1 UTSW 2 121,101,009 (GRCm39) missense possibly damaging 0.95
R0648:Trp53bp1 UTSW 2 121,066,188 (GRCm39) missense probably benign 0.20
R0680:Trp53bp1 UTSW 2 121,082,349 (GRCm39) missense probably null 0.13
R0732:Trp53bp1 UTSW 2 121,078,745 (GRCm39) missense probably null 0.96
R0905:Trp53bp1 UTSW 2 121,034,799 (GRCm39) splice site probably benign
R1377:Trp53bp1 UTSW 2 121,101,123 (GRCm39) missense probably damaging 1.00
R1415:Trp53bp1 UTSW 2 121,066,665 (GRCm39) missense probably damaging 1.00
R1725:Trp53bp1 UTSW 2 121,082,481 (GRCm39) missense possibly damaging 0.46
R1971:Trp53bp1 UTSW 2 121,035,517 (GRCm39) missense probably damaging 1.00
R2045:Trp53bp1 UTSW 2 121,034,964 (GRCm39) missense probably benign
R2143:Trp53bp1 UTSW 2 121,046,545 (GRCm39) missense probably benign 0.00
R2282:Trp53bp1 UTSW 2 121,100,754 (GRCm39) nonsense probably null
R2296:Trp53bp1 UTSW 2 121,039,728 (GRCm39) missense possibly damaging 0.96
R3106:Trp53bp1 UTSW 2 121,067,133 (GRCm39) missense probably damaging 1.00
R3792:Trp53bp1 UTSW 2 121,030,810 (GRCm39) missense probably damaging 1.00
R3793:Trp53bp1 UTSW 2 121,030,810 (GRCm39) missense probably damaging 1.00
R3946:Trp53bp1 UTSW 2 121,059,107 (GRCm39) missense probably damaging 0.99
R4001:Trp53bp1 UTSW 2 121,035,566 (GRCm39) missense probably damaging 1.00
R4327:Trp53bp1 UTSW 2 121,087,131 (GRCm39) missense probably damaging 1.00
R4585:Trp53bp1 UTSW 2 121,038,432 (GRCm39) missense probably damaging 1.00
R4630:Trp53bp1 UTSW 2 121,038,368 (GRCm39) missense probably damaging 1.00
R4744:Trp53bp1 UTSW 2 121,041,794 (GRCm39) missense probably damaging 1.00
R4751:Trp53bp1 UTSW 2 121,058,290 (GRCm39) missense probably damaging 1.00
R4754:Trp53bp1 UTSW 2 121,038,360 (GRCm39) missense probably damaging 1.00
R4755:Trp53bp1 UTSW 2 121,059,087 (GRCm39) nonsense probably null
R4850:Trp53bp1 UTSW 2 121,035,594 (GRCm39) critical splice acceptor site probably null
R4870:Trp53bp1 UTSW 2 121,087,122 (GRCm39) missense probably damaging 1.00
R4879:Trp53bp1 UTSW 2 121,033,084 (GRCm39) missense probably damaging 0.99
R4924:Trp53bp1 UTSW 2 121,051,701 (GRCm39) nonsense probably null
R4962:Trp53bp1 UTSW 2 121,101,027 (GRCm39) missense probably benign 0.12
R5019:Trp53bp1 UTSW 2 121,100,800 (GRCm39) splice site probably null
R5111:Trp53bp1 UTSW 2 121,041,868 (GRCm39) missense probably damaging 0.99
R5149:Trp53bp1 UTSW 2 121,046,598 (GRCm39) missense probably benign 0.00
R5252:Trp53bp1 UTSW 2 121,074,464 (GRCm39) missense probably benign 0.40
R5533:Trp53bp1 UTSW 2 121,038,227 (GRCm39) missense probably damaging 1.00
R5642:Trp53bp1 UTSW 2 121,067,143 (GRCm39) missense probably benign 0.00
R5773:Trp53bp1 UTSW 2 121,074,395 (GRCm39) missense probably damaging 1.00
R5819:Trp53bp1 UTSW 2 121,038,873 (GRCm39) nonsense probably null
R5886:Trp53bp1 UTSW 2 121,035,502 (GRCm39) missense probably damaging 1.00
R5908:Trp53bp1 UTSW 2 121,067,304 (GRCm39) missense probably benign 0.06
R6012:Trp53bp1 UTSW 2 121,087,083 (GRCm39) missense probably benign 0.07
R6351:Trp53bp1 UTSW 2 121,100,426 (GRCm39) missense probably damaging 1.00
R6406:Trp53bp1 UTSW 2 121,101,093 (GRCm39) missense probably damaging 0.99
R6575:Trp53bp1 UTSW 2 121,059,084 (GRCm39) missense probably damaging 1.00
R6619:Trp53bp1 UTSW 2 121,077,980 (GRCm39) critical splice donor site probably null
R6626:Trp53bp1 UTSW 2 121,038,284 (GRCm39) missense probably damaging 1.00
R6754:Trp53bp1 UTSW 2 121,101,057 (GRCm39) missense possibly damaging 0.83
R6765:Trp53bp1 UTSW 2 121,039,790 (GRCm39) missense probably damaging 1.00
R6806:Trp53bp1 UTSW 2 121,059,147 (GRCm39) missense probably damaging 0.99
R6860:Trp53bp1 UTSW 2 121,029,594 (GRCm39) missense probably damaging 1.00
R6991:Trp53bp1 UTSW 2 121,038,521 (GRCm39) missense probably damaging 1.00
R7278:Trp53bp1 UTSW 2 121,029,516 (GRCm39) missense probably damaging 1.00
R7357:Trp53bp1 UTSW 2 121,041,781 (GRCm39) missense probably damaging 1.00
R7477:Trp53bp1 UTSW 2 121,066,827 (GRCm39) missense probably benign 0.34
R7577:Trp53bp1 UTSW 2 121,067,119 (GRCm39) missense possibly damaging 0.65
R7643:Trp53bp1 UTSW 2 121,078,295 (GRCm39) splice site probably null
R7728:Trp53bp1 UTSW 2 121,038,380 (GRCm39) missense probably damaging 1.00
R7806:Trp53bp1 UTSW 2 121,035,542 (GRCm39) missense probably damaging 0.99
R7955:Trp53bp1 UTSW 2 121,066,225 (GRCm39) missense possibly damaging 0.59
R8099:Trp53bp1 UTSW 2 121,030,230 (GRCm39) missense probably damaging 1.00
R8200:Trp53bp1 UTSW 2 121,066,657 (GRCm39) missense probably benign 0.00
R8282:Trp53bp1 UTSW 2 121,029,523 (GRCm39) missense probably damaging 0.99
R9136:Trp53bp1 UTSW 2 121,067,092 (GRCm39) missense possibly damaging 0.84
R9152:Trp53bp1 UTSW 2 121,029,056 (GRCm39) missense probably damaging 0.99
R9292:Trp53bp1 UTSW 2 121,046,177 (GRCm39) missense probably damaging 0.97
R9340:Trp53bp1 UTSW 2 121,100,460 (GRCm39) missense probably benign 0.40
R9475:Trp53bp1 UTSW 2 121,039,761 (GRCm39) missense probably benign 0.00
R9616:Trp53bp1 UTSW 2 121,066,657 (GRCm39) missense probably benign 0.30
R9675:Trp53bp1 UTSW 2 121,087,089 (GRCm39) missense probably benign 0.03
R9779:Trp53bp1 UTSW 2 121,066,469 (GRCm39) missense probably damaging 1.00
RF046:Trp53bp1 UTSW 2 121,046,482 (GRCm39) frame shift probably null
Z1088:Trp53bp1 UTSW 2 121,084,126 (GRCm39) missense probably benign 0.04
Z1177:Trp53bp1 UTSW 2 121,074,541 (GRCm39) missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- ACTTCCACAGGGAGTCTCAG -3'
(R):5'- TTCTCCCAGGACTGAGGAAGAC -3'

Sequencing Primer
(F):5'- CGAAAACCCTTCCTCTGGATGG -3'
(R):5'- CAGAGAGAACACACAGATTGACG -3'
Posted On 2019-09-13