Incidental Mutation 'R7339:Trp53bp1'
ID569684
Institutional Source Beutler Lab
Gene Symbol Trp53bp1
Ensembl Gene ENSMUSG00000043909
Gene Nametransformation related protein 53 binding protein 1
Synonyms53BP1, p53BP1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7339 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location121193281-121271407 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 121236469 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 592 (D592G)
Ref Sequence ENSEMBL: ENSMUSP00000106277 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110647] [ENSMUST00000110648] [ENSMUST00000129752] [ENSMUST00000131245]
Predicted Effect probably benign
Transcript: ENSMUST00000110647
AA Change: D592G

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000106277
Gene: ENSMUSG00000043909
AA Change: D592G

DomainStartEndE-ValueType
low complexity region 136 149 N/A INTRINSIC
low complexity region 158 169 N/A INTRINSIC
low complexity region 647 661 N/A INTRINSIC
low complexity region 1031 1042 N/A INTRINSIC
low complexity region 1099 1112 N/A INTRINSIC
low complexity region 1260 1272 N/A INTRINSIC
low complexity region 1290 1332 N/A INTRINSIC
Pfam:53-BP1_Tudor 1430 1551 2.5e-80 PFAM
low complexity region 1581 1601 N/A INTRINSIC
BRCT 1673 1785 7.13e-1 SMART
BRCT 1813 1901 1.03e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110648
AA Change: D592G

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000106278
Gene: ENSMUSG00000043909
AA Change: D592G

DomainStartEndE-ValueType
low complexity region 136 149 N/A INTRINSIC
low complexity region 158 169 N/A INTRINSIC
low complexity region 647 661 N/A INTRINSIC
low complexity region 1031 1042 N/A INTRINSIC
low complexity region 1099 1112 N/A INTRINSIC
low complexity region 1260 1272 N/A INTRINSIC
low complexity region 1290 1332 N/A INTRINSIC
low complexity region 1389 1409 N/A INTRINSIC
Pfam:53-BP1_Tudor 1480 1601 1.5e-80 PFAM
low complexity region 1631 1651 N/A INTRINSIC
BRCT 1723 1835 7.13e-1 SMART
BRCT 1863 1951 1.03e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129752
Predicted Effect probably benign
Transcript: ENSMUST00000131245
AA Change: D592G

PolyPhen 2 Score 0.204 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000114457
Gene: ENSMUSG00000043909
AA Change: D592G

DomainStartEndE-ValueType
low complexity region 136 149 N/A INTRINSIC
low complexity region 158 169 N/A INTRINSIC
low complexity region 647 661 N/A INTRINSIC
low complexity region 991 1002 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142400
Predicted Effect probably benign
Transcript: ENSMUST00000147540
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (61/61)
MGI Phenotype PHENOTYPE: Homozygous mutations in this gene result in growth retardation, immunodeficiency, thymic hypoplasia, and increased incidence of thymic lymphomas. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik G A 11: 78,272,384 probably null Het
2900026A02Rik T C 5: 113,183,072 D1092G probably benign Het
9030624J02Rik A T 7: 118,809,971 I612F probably damaging Het
Abcb11 C T 2: 69,299,867 D282N probably damaging Het
Ahnak A T 19: 9,008,165 N2271I possibly damaging Het
Amz1 A G 5: 140,741,551 S90G probably benign Het
Arhgap5 A G 12: 52,517,698 E484G possibly damaging Het
Arid3c A G 4: 41,729,883 probably null Het
Atp1a1 T C 3: 101,589,872 I373V probably benign Het
Barhl1 T C 2: 28,909,887 E242G probably damaging Het
Cactin CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG 10: 81,321,318 probably benign Het
Casz1 T A 4: 148,951,745 V1488E probably damaging Het
Ccdc175 C A 12: 72,136,041 Q401H probably damaging Het
Cfap36 T C 11: 29,225,925 Y191C probably benign Het
Chmp2b G A 16: 65,545,346 Q119* probably null Het
Cps1 T A 1: 67,197,015 I969N possibly damaging Het
Dennd5a A G 7: 109,901,159 F920L probably damaging Het
Dnah12 A T 14: 26,872,320 T3410S probably benign Het
Fbxo42 T G 4: 141,200,144 S578R possibly damaging Het
Fcgr1 C T 3: 96,284,299 G398R not run Het
Foxa3 A T 7: 19,014,869 Y111N probably damaging Het
Gabbr2 T C 4: 46,846,340 K190E probably benign Het
Gbp10 T C 5: 105,220,098 Y403C possibly damaging Het
Gm906 A T 13: 50,247,168 I374N possibly damaging Het
Hsd3b5 A G 3: 98,622,074 I80T probably damaging Het
Kri1 T G 9: 21,286,587 Q89P Het
Lrp6 G T 6: 134,450,818 P1604T probably damaging Het
Metap1 T C 3: 138,466,137 probably null Het
Mkrn3 C T 7: 62,419,782 R87H probably benign Het
Ms4a6d G A 19: 11,590,073 Q155* probably null Het
Myh6 T C 14: 54,961,568 probably null Het
Naip6 G T 13: 100,316,019 P178Q probably damaging Het
Ncapg2 A G 12: 116,414,834 E160G probably damaging Het
Nek6 G A 2: 38,560,965 A127T probably damaging Het
Nell1 T C 7: 50,279,549 V264A probably benign Het
Nlrp2 T A 7: 5,327,628 I590F possibly damaging Het
Olfr1308 A T 2: 111,960,611 M154K probably benign Het
Olfr1310 A G 2: 112,008,475 L237P probably damaging Het
Olfr1390 G A 11: 49,341,048 R172Q not run Het
Olfr503 A C 7: 108,544,900 D125A probably damaging Het
Olfr71 C T 4: 43,706,080 A163T probably benign Het
Otop3 T A 11: 115,346,378 L556Q probably damaging Het
Padi1 T C 4: 140,829,234 D190G probably null Het
Pald1 T C 10: 61,323,331 S774G possibly damaging Het
Pde10a C T 17: 8,757,028 T55I probably benign Het
Pla2g4d T C 2: 120,278,978 M197V probably benign Het
Prom1 C A 5: 44,101,653 probably benign Het
Ptdss1 A G 13: 66,963,362 H164R possibly damaging Het
Rrh A T 3: 129,810,613 I313N probably damaging Het
Slc35b4 A G 6: 34,167,656 I88T probably damaging Het
Slc38a11 C T 2: 65,326,570 V353I probably benign Het
Spdef T A 17: 27,720,245 E42D probably benign Het
Tgoln1 G C 6: 72,616,278 T73R probably benign Het
Tmx1 A G 12: 70,458,850 D129G probably benign Het
Trav13n-4 A T 14: 53,363,978 Y68F probably benign Het
Trp53 T C 11: 69,589,189 S238P probably damaging Het
Ttll5 T C 12: 85,857,464 probably null Het
Urb1 CACTTAC CAC 16: 90,772,573 probably benign Het
Vmn2r43 A T 7: 8,255,307 Y302* probably null Het
Vps13d C T 4: 145,121,368 V2478I Het
Wsb1 A G 11: 79,240,358 V404A probably damaging Het
Zfc3h1 A G 10: 115,403,300 D539G probably damaging Het
Zfp318 T C 17: 46,411,247 V1392A probably damaging Het
Other mutations in Trp53bp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Trp53bp1 APN 2 121256579 missense possibly damaging 0.69
IGL00690:Trp53bp1 APN 2 121235995 missense probably damaging 1.00
IGL00922:Trp53bp1 APN 2 121208482 missense probably damaging 0.96
IGL01475:Trp53bp1 APN 2 121270319 splice site probably null
IGL01639:Trp53bp1 APN 2 121202692 missense possibly damaging 0.51
IGL01662:Trp53bp1 APN 2 121236025 missense probably damaging 1.00
IGL01757:Trp53bp1 APN 2 121211304 missense probably damaging 0.99
IGL01829:Trp53bp1 APN 2 121215896 missense probably benign 0.39
IGL02247:Trp53bp1 APN 2 121236589 missense probably damaging 1.00
IGL02349:Trp53bp1 APN 2 121199074 missense probably damaging 1.00
IGL02391:Trp53bp1 APN 2 121202710 missense possibly damaging 0.67
chives UTSW 2 121251868 missense probably null 0.13
concur UTSW 2 121270319 splice site probably null
confirmation UTSW 2 121205113 critical splice acceptor site probably null
Infra UTSW 2 121247499 critical splice donor site probably null
lentil UTSW 2 121251868 missense probably null 0.13
lentil2 UTSW 2 121207887 missense probably damaging 1.00
Profundus UTSW 2 121207803 missense probably damaging 1.00
split_pea UTSW 2 121228606 nonsense probably null
verily UTSW 2 121211313 missense probably damaging 1.00
PIT1430001:Trp53bp1 UTSW 2 121271275 missense probably damaging 1.00
R0045:Trp53bp1 UTSW 2 121204497 missense probably benign
R0060:Trp53bp1 UTSW 2 121204525 missense probably damaging 1.00
R0060:Trp53bp1 UTSW 2 121204525 missense probably damaging 1.00
R0103:Trp53bp1 UTSW 2 121236759 missense possibly damaging 0.92
R0103:Trp53bp1 UTSW 2 121236759 missense possibly damaging 0.92
R0281:Trp53bp1 UTSW 2 121270237 missense probably damaging 1.00
R0386:Trp53bp1 UTSW 2 121204943 missense probably damaging 1.00
R0427:Trp53bp1 UTSW 2 121236017 missense probably damaging 1.00
R0505:Trp53bp1 UTSW 2 121269969 missense probably damaging 0.99
R0522:Trp53bp1 UTSW 2 121251868 missense probably null 0.13
R0523:Trp53bp1 UTSW 2 121251868 missense probably null 0.13
R0525:Trp53bp1 UTSW 2 121251868 missense probably null 0.13
R0543:Trp53bp1 UTSW 2 121251868 missense probably null 0.13
R0559:Trp53bp1 UTSW 2 121227801 missense probably damaging 1.00
R0573:Trp53bp1 UTSW 2 121228172 splice site probably benign
R0593:Trp53bp1 UTSW 2 121270528 missense possibly damaging 0.95
R0648:Trp53bp1 UTSW 2 121235707 missense probably benign 0.20
R0680:Trp53bp1 UTSW 2 121251868 missense probably null 0.13
R0732:Trp53bp1 UTSW 2 121248264 missense probably null 0.96
R0905:Trp53bp1 UTSW 2 121204318 splice site probably benign
R1377:Trp53bp1 UTSW 2 121270642 missense probably damaging 1.00
R1415:Trp53bp1 UTSW 2 121236184 missense probably damaging 1.00
R1725:Trp53bp1 UTSW 2 121252000 missense possibly damaging 0.46
R1971:Trp53bp1 UTSW 2 121205036 missense probably damaging 1.00
R2045:Trp53bp1 UTSW 2 121204483 missense probably benign
R2143:Trp53bp1 UTSW 2 121216064 missense probably benign 0.00
R2282:Trp53bp1 UTSW 2 121270273 nonsense probably null
R2296:Trp53bp1 UTSW 2 121209247 missense possibly damaging 0.96
R3106:Trp53bp1 UTSW 2 121236652 missense probably damaging 1.00
R3792:Trp53bp1 UTSW 2 121200329 missense probably damaging 1.00
R3793:Trp53bp1 UTSW 2 121200329 missense probably damaging 1.00
R3946:Trp53bp1 UTSW 2 121228626 missense probably damaging 0.99
R4001:Trp53bp1 UTSW 2 121205085 missense probably damaging 1.00
R4327:Trp53bp1 UTSW 2 121256650 missense probably damaging 1.00
R4585:Trp53bp1 UTSW 2 121207951 missense probably damaging 1.00
R4630:Trp53bp1 UTSW 2 121207887 missense probably damaging 1.00
R4744:Trp53bp1 UTSW 2 121211313 missense probably damaging 1.00
R4751:Trp53bp1 UTSW 2 121227809 missense probably damaging 1.00
R4754:Trp53bp1 UTSW 2 121207879 missense probably damaging 1.00
R4755:Trp53bp1 UTSW 2 121228606 nonsense probably null
R4850:Trp53bp1 UTSW 2 121205113 critical splice acceptor site probably null
R4870:Trp53bp1 UTSW 2 121256641 missense probably damaging 1.00
R4879:Trp53bp1 UTSW 2 121202603 missense probably damaging 0.99
R4924:Trp53bp1 UTSW 2 121221220 nonsense probably null
R4962:Trp53bp1 UTSW 2 121270546 missense probably benign 0.12
R5019:Trp53bp1 UTSW 2 121270319 splice site probably null
R5111:Trp53bp1 UTSW 2 121211387 missense probably damaging 0.99
R5149:Trp53bp1 UTSW 2 121216117 missense probably benign 0.00
R5252:Trp53bp1 UTSW 2 121243983 missense probably benign 0.40
R5533:Trp53bp1 UTSW 2 121207746 missense probably damaging 1.00
R5642:Trp53bp1 UTSW 2 121236662 missense probably benign 0.00
R5773:Trp53bp1 UTSW 2 121243914 missense probably damaging 1.00
R5819:Trp53bp1 UTSW 2 121208392 nonsense probably null
R5886:Trp53bp1 UTSW 2 121205021 missense probably damaging 1.00
R5908:Trp53bp1 UTSW 2 121236823 missense probably benign 0.06
R6012:Trp53bp1 UTSW 2 121256602 missense probably benign 0.07
R6351:Trp53bp1 UTSW 2 121269945 missense probably damaging 1.00
R6406:Trp53bp1 UTSW 2 121270612 missense probably damaging 0.99
R6575:Trp53bp1 UTSW 2 121228603 missense probably damaging 1.00
R6619:Trp53bp1 UTSW 2 121247499 critical splice donor site probably null
R6626:Trp53bp1 UTSW 2 121207803 missense probably damaging 1.00
R6754:Trp53bp1 UTSW 2 121270576 missense possibly damaging 0.83
R6765:Trp53bp1 UTSW 2 121209309 missense probably damaging 1.00
R6806:Trp53bp1 UTSW 2 121228666 missense probably damaging 0.99
R6860:Trp53bp1 UTSW 2 121199113 missense probably damaging 1.00
R6991:Trp53bp1 UTSW 2 121208040 missense probably damaging 1.00
R7278:Trp53bp1 UTSW 2 121199035 missense probably damaging 1.00
R7357:Trp53bp1 UTSW 2 121211300 missense probably damaging 1.00
R7477:Trp53bp1 UTSW 2 121236346 missense probably benign 0.34
R7577:Trp53bp1 UTSW 2 121236638 missense possibly damaging 0.65
R7728:Trp53bp1 UTSW 2 121207899 missense probably damaging 1.00
R7806:Trp53bp1 UTSW 2 121205061 missense probably damaging 0.99
RF046:Trp53bp1 UTSW 2 121216001 frame shift probably null
Z1088:Trp53bp1 UTSW 2 121253645 missense probably benign 0.04
Z1177:Trp53bp1 UTSW 2 121244060 missense not run
Predicted Primers PCR Primer
(F):5'- ACTTCCACAGGGAGTCTCAG -3'
(R):5'- TTCTCCCAGGACTGAGGAAGAC -3'

Sequencing Primer
(F):5'- CGAAAACCCTTCCTCTGGATGG -3'
(R):5'- CAGAGAGAACACACAGATTGACG -3'
Posted On2019-09-13