Mutagenetix > Incidental Mutations

Incidental Mutation 'R7339:Trp53bp1'

569684

Institutional Source

Beutler Lab

Gene Symbol

Trp53bp1

Ensembl Gene

ENSMUSG00000043909

Gene Name

transformation related protein 53 binding protein 1

Synonyms

53BP1, p53BP1

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7339 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

121193281-121271407 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 121236469 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 592 (D592G)

Ref Sequence

ENSEMBL: ENSMUSP00000106277 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000110647] [ENSMUST00000110648] [ENSMUST00000129752] [ENSMUST00000131245]

Predicted Effect

probably benign
Transcript: ENSMUST00000110647
AA Change: D592G

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000106277
Gene: ENSMUSG00000043909
AA Change: D592G

Domain	Start	End	E-Value	Type
low complexity region	136	149	N/A	INTRINSIC
low complexity region	158	169	N/A	INTRINSIC
low complexity region	647	661	N/A	INTRINSIC
low complexity region	1031	1042	N/A	INTRINSIC
low complexity region	1099	1112	N/A	INTRINSIC
low complexity region	1260	1272	N/A	INTRINSIC
low complexity region	1290	1332	N/A	INTRINSIC
Pfam:53-BP1_Tudor	1430	1551	2.5e-80	PFAM
low complexity region	1581	1601	N/A	INTRINSIC
BRCT	1673	1785	7.13e-1	SMART
BRCT	1813	1901	1.03e-6	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000110648
AA Change: D592G

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000106278
Gene: ENSMUSG00000043909
AA Change: D592G

Domain	Start	End	E-Value	Type
low complexity region	136	149	N/A	INTRINSIC
low complexity region	158	169	N/A	INTRINSIC
low complexity region	647	661	N/A	INTRINSIC
low complexity region	1031	1042	N/A	INTRINSIC
low complexity region	1099	1112	N/A	INTRINSIC
low complexity region	1260	1272	N/A	INTRINSIC
low complexity region	1290	1332	N/A	INTRINSIC
low complexity region	1389	1409	N/A	INTRINSIC
Pfam:53-BP1_Tudor	1480	1601	1.5e-80	PFAM
low complexity region	1631	1651	N/A	INTRINSIC
BRCT	1723	1835	7.13e-1	SMART
BRCT	1863	1951	1.03e-6	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000129752

Predicted Effect

probably benign
Transcript: ENSMUST00000131245
AA Change: D592G

PolyPhen 2 Score 0.204 (Sensitivity: 0.92; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000114457
Gene: ENSMUSG00000043909
AA Change: D592G

Domain	Start	End	E-Value	Type
low complexity region	136	149	N/A	INTRINSIC
low complexity region	158	169	N/A	INTRINSIC
low complexity region	647	661	N/A	INTRINSIC
low complexity region	991	1002	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000142400

Predicted Effect

probably benign
Transcript: ENSMUST00000147540

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (61/61)

MGI Phenotype

PHENOTYPE: Homozygous mutations in this gene result in growth retardation, immunodeficiency, thymic hypoplasia, and increased incidence of thymic lymphomas. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610507B11Rik	G	A	11: 78,272,384		probably null	Het
2900026A02Rik	T	C	5: 113,183,072	D1092G	probably benign	Het
9030624J02Rik	A	T	7: 118,809,971	I612F	probably damaging	Het
Abcb11	C	T	2: 69,299,867	D282N	probably damaging	Het
Ahnak	A	T	19: 9,008,165	N2271I	possibly damaging	Het
Amz1	A	G	5: 140,741,551	S90G	probably benign	Het
Arhgap5	A	G	12: 52,517,698	E484G	possibly damaging	Het
Arid3c	A	G	4: 41,729,883		probably null	Het
Atp1a1	T	C	3: 101,589,872	I373V	probably benign	Het
Barhl1	T	C	2: 28,909,887	E242G	probably damaging	Het
Cactin	CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG	CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG	10: 81,321,318		probably benign	Het
Casz1	T	A	4: 148,951,745	V1488E	probably damaging	Het
Ccdc175	C	A	12: 72,136,041	Q401H	probably damaging	Het
Cfap36	T	C	11: 29,225,925	Y191C	probably benign	Het
Chmp2b	G	A	16: 65,545,346	Q119*	probably null	Het
Cps1	T	A	1: 67,197,015	I969N	possibly damaging	Het
Dennd5a	A	G	7: 109,901,159	F920L	probably damaging	Het
Dnah12	A	T	14: 26,872,320	T3410S	probably benign	Het
Fbxo42	T	G	4: 141,200,144	S578R	possibly damaging	Het
Fcgr1	C	T	3: 96,284,299	G398R	not run	Het
Foxa3	A	T	7: 19,014,869	Y111N	probably damaging	Het
Gabbr2	T	C	4: 46,846,340	K190E	probably benign	Het
Gbp10	T	C	5: 105,220,098	Y403C	possibly damaging	Het
Gm906	A	T	13: 50,247,168	I374N	possibly damaging	Het
Hsd3b5	A	G	3: 98,622,074	I80T	probably damaging	Het
Kri1	T	G	9: 21,286,587	Q89P		Het
Lrp6	G	T	6: 134,450,818	P1604T	probably damaging	Het
Metap1	T	C	3: 138,466,137		probably null	Het
Mkrn3	C	T	7: 62,419,782	R87H	probably benign	Het
Ms4a6d	G	A	19: 11,590,073	Q155*	probably null	Het
Myh6	T	C	14: 54,961,568		probably null	Het
Naip6	G	T	13: 100,316,019	P178Q	probably damaging	Het
Ncapg2	A	G	12: 116,414,834	E160G	probably damaging	Het
Nek6	G	A	2: 38,560,965	A127T	probably damaging	Het
Nell1	T	C	7: 50,279,549	V264A	probably benign	Het
Nlrp2	T	A	7: 5,327,628	I590F	possibly damaging	Het
Olfr1308	A	T	2: 111,960,611	M154K	probably benign	Het
Olfr1310	A	G	2: 112,008,475	L237P	probably damaging	Het
Olfr1390	G	A	11: 49,341,048	R172Q	not run	Het
Olfr503	A	C	7: 108,544,900	D125A	probably damaging	Het
Olfr71	C	T	4: 43,706,080	A163T	probably benign	Het
Otop3	T	A	11: 115,346,378	L556Q	probably damaging	Het
Padi1	T	C	4: 140,829,234	D190G	probably null	Het
Pald1	T	C	10: 61,323,331	S774G	possibly damaging	Het
Pde10a	C	T	17: 8,757,028	T55I	probably benign	Het
Pla2g4d	T	C	2: 120,278,978	M197V	probably benign	Het
Prom1	C	A	5: 44,101,653		probably benign	Het
Ptdss1	A	G	13: 66,963,362	H164R	possibly damaging	Het
Rrh	A	T	3: 129,810,613	I313N	probably damaging	Het
Slc35b4	A	G	6: 34,167,656	I88T	probably damaging	Het
Slc38a11	C	T	2: 65,326,570	V353I	probably benign	Het
Spdef	T	A	17: 27,720,245	E42D	probably benign	Het
Tgoln1	G	C	6: 72,616,278	T73R	probably benign	Het
Tmx1	A	G	12: 70,458,850	D129G	probably benign	Het
Trav13n-4	A	T	14: 53,363,978	Y68F	probably benign	Het
Trp53	T	C	11: 69,589,189	S238P	probably damaging	Het
Ttll5	T	C	12: 85,857,464		probably null	Het
Urb1	CACTTAC	CAC	16: 90,772,573		probably benign	Het
Vmn2r43	A	T	7: 8,255,307	Y302*	probably null	Het
Vps13d	C	T	4: 145,121,368	V2478I		Het
Wsb1	A	G	11: 79,240,358	V404A	probably damaging	Het
Zfc3h1	A	G	10: 115,403,300	D539G	probably damaging	Het
Zfp318	T	C	17: 46,411,247	V1392A	probably damaging	Het

Other mutations in Trp53bp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00336:Trp53bp1	APN	2	121256579	missense	possibly damaging	0.69
IGL00690:Trp53bp1	APN	2	121235995	missense	probably damaging	1.00
IGL00922:Trp53bp1	APN	2	121208482	missense	probably damaging	0.96
IGL01475:Trp53bp1	APN	2	121270319	splice site	probably null
IGL01639:Trp53bp1	APN	2	121202692	missense	possibly damaging	0.51
IGL01662:Trp53bp1	APN	2	121236025	missense	probably damaging	1.00
IGL01757:Trp53bp1	APN	2	121211304	missense	probably damaging	0.99
IGL01829:Trp53bp1	APN	2	121215896	missense	probably benign	0.39
IGL02247:Trp53bp1	APN	2	121236589	missense	probably damaging	1.00
IGL02349:Trp53bp1	APN	2	121199074	missense	probably damaging	1.00
IGL02391:Trp53bp1	APN	2	121202710	missense	possibly damaging	0.67
chives	UTSW	2	121251868	missense	probably null	0.13
concur	UTSW	2	121270319	splice site	probably null
confirmation	UTSW	2	121205113	critical splice acceptor site	probably null
Infra	UTSW	2	121247499	critical splice donor site	probably null
lentil	UTSW	2	121251868	missense	probably null	0.13
lentil2	UTSW	2	121207887	missense	probably damaging	1.00
Profundus	UTSW	2	121207803	missense	probably damaging	1.00
split_pea	UTSW	2	121228606	nonsense	probably null
verily	UTSW	2	121211313	missense	probably damaging	1.00
PIT1430001:Trp53bp1	UTSW	2	121271275	missense	probably damaging	1.00
R0045:Trp53bp1	UTSW	2	121204497	missense	probably benign
R0060:Trp53bp1	UTSW	2	121204525	missense	probably damaging	1.00
R0060:Trp53bp1	UTSW	2	121204525	missense	probably damaging	1.00
R0103:Trp53bp1	UTSW	2	121236759	missense	possibly damaging	0.92
R0103:Trp53bp1	UTSW	2	121236759	missense	possibly damaging	0.92
R0281:Trp53bp1	UTSW	2	121270237	missense	probably damaging	1.00
R0386:Trp53bp1	UTSW	2	121204943	missense	probably damaging	1.00
R0427:Trp53bp1	UTSW	2	121236017	missense	probably damaging	1.00
R0505:Trp53bp1	UTSW	2	121269969	missense	probably damaging	0.99
R0522:Trp53bp1	UTSW	2	121251868	missense	probably null	0.13
R0523:Trp53bp1	UTSW	2	121251868	missense	probably null	0.13
R0525:Trp53bp1	UTSW	2	121251868	missense	probably null	0.13
R0543:Trp53bp1	UTSW	2	121251868	missense	probably null	0.13
R0559:Trp53bp1	UTSW	2	121227801	missense	probably damaging	1.00
R0573:Trp53bp1	UTSW	2	121228172	splice site	probably benign
R0593:Trp53bp1	UTSW	2	121270528	missense	possibly damaging	0.95
R0648:Trp53bp1	UTSW	2	121235707	missense	probably benign	0.20
R0680:Trp53bp1	UTSW	2	121251868	missense	probably null	0.13
R0732:Trp53bp1	UTSW	2	121248264	missense	probably null	0.96
R0905:Trp53bp1	UTSW	2	121204318	splice site	probably benign
R1377:Trp53bp1	UTSW	2	121270642	missense	probably damaging	1.00
R1415:Trp53bp1	UTSW	2	121236184	missense	probably damaging	1.00
R1725:Trp53bp1	UTSW	2	121252000	missense	possibly damaging	0.46
R1971:Trp53bp1	UTSW	2	121205036	missense	probably damaging	1.00
R2045:Trp53bp1	UTSW	2	121204483	missense	probably benign
R2143:Trp53bp1	UTSW	2	121216064	missense	probably benign	0.00
R2282:Trp53bp1	UTSW	2	121270273	nonsense	probably null
R2296:Trp53bp1	UTSW	2	121209247	missense	possibly damaging	0.96
R3106:Trp53bp1	UTSW	2	121236652	missense	probably damaging	1.00
R3792:Trp53bp1	UTSW	2	121200329	missense	probably damaging	1.00
R3793:Trp53bp1	UTSW	2	121200329	missense	probably damaging	1.00
R3946:Trp53bp1	UTSW	2	121228626	missense	probably damaging	0.99
R4001:Trp53bp1	UTSW	2	121205085	missense	probably damaging	1.00
R4327:Trp53bp1	UTSW	2	121256650	missense	probably damaging	1.00
R4585:Trp53bp1	UTSW	2	121207951	missense	probably damaging	1.00
R4630:Trp53bp1	UTSW	2	121207887	missense	probably damaging	1.00
R4744:Trp53bp1	UTSW	2	121211313	missense	probably damaging	1.00
R4751:Trp53bp1	UTSW	2	121227809	missense	probably damaging	1.00
R4754:Trp53bp1	UTSW	2	121207879	missense	probably damaging	1.00
R4755:Trp53bp1	UTSW	2	121228606	nonsense	probably null
R4850:Trp53bp1	UTSW	2	121205113	critical splice acceptor site	probably null
R4870:Trp53bp1	UTSW	2	121256641	missense	probably damaging	1.00
R4879:Trp53bp1	UTSW	2	121202603	missense	probably damaging	0.99
R4924:Trp53bp1	UTSW	2	121221220	nonsense	probably null
R4962:Trp53bp1	UTSW	2	121270546	missense	probably benign	0.12
R5019:Trp53bp1	UTSW	2	121270319	splice site	probably null
R5111:Trp53bp1	UTSW	2	121211387	missense	probably damaging	0.99
R5149:Trp53bp1	UTSW	2	121216117	missense	probably benign	0.00
R5252:Trp53bp1	UTSW	2	121243983	missense	probably benign	0.40
R5533:Trp53bp1	UTSW	2	121207746	missense	probably damaging	1.00
R5642:Trp53bp1	UTSW	2	121236662	missense	probably benign	0.00
R5773:Trp53bp1	UTSW	2	121243914	missense	probably damaging	1.00
R5819:Trp53bp1	UTSW	2	121208392	nonsense	probably null
R5886:Trp53bp1	UTSW	2	121205021	missense	probably damaging	1.00
R5908:Trp53bp1	UTSW	2	121236823	missense	probably benign	0.06
R6012:Trp53bp1	UTSW	2	121256602	missense	probably benign	0.07
R6351:Trp53bp1	UTSW	2	121269945	missense	probably damaging	1.00
R6406:Trp53bp1	UTSW	2	121270612	missense	probably damaging	0.99
R6575:Trp53bp1	UTSW	2	121228603	missense	probably damaging	1.00
R6619:Trp53bp1	UTSW	2	121247499	critical splice donor site	probably null
R6626:Trp53bp1	UTSW	2	121207803	missense	probably damaging	1.00
R6754:Trp53bp1	UTSW	2	121270576	missense	possibly damaging	0.83
R6765:Trp53bp1	UTSW	2	121209309	missense	probably damaging	1.00
R6806:Trp53bp1	UTSW	2	121228666	missense	probably damaging	0.99
R6860:Trp53bp1	UTSW	2	121199113	missense	probably damaging	1.00
R6991:Trp53bp1	UTSW	2	121208040	missense	probably damaging	1.00
R7278:Trp53bp1	UTSW	2	121199035	missense	probably damaging	1.00
R7357:Trp53bp1	UTSW	2	121211300	missense	probably damaging	1.00
R7477:Trp53bp1	UTSW	2	121236346	missense	probably benign	0.34
R7577:Trp53bp1	UTSW	2	121236638	missense	possibly damaging	0.65
R7728:Trp53bp1	UTSW	2	121207899	missense	probably damaging	1.00
R7806:Trp53bp1	UTSW	2	121205061	missense	probably damaging	0.99
RF046:Trp53bp1	UTSW	2	121216001	frame shift	probably null
Z1088:Trp53bp1	UTSW	2	121253645	missense	probably benign	0.04
Z1177:Trp53bp1	UTSW	2	121244060	missense	not run

Predicted Primers

PCR Primer
(F):5'- ACTTCCACAGGGAGTCTCAG -3'
(R):5'- TTCTCCCAGGACTGAGGAAGAC -3'

Sequencing Primer
(F):5'- CGAAAACCCTTCCTCTGGATGG -3'
(R):5'- CAGAGAGAACACACAGATTGACG -3'

Posted On

2019-09-13