Incidental Mutation 'R7339:Hsd3b5'
ID 569686
Institutional Source Beutler Lab
Gene Symbol Hsd3b5
Ensembl Gene ENSMUSG00000038092
Gene Name hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 5
Synonyms 3(beta)HSDV
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock # R7339 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 98618634-98630252 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 98622074 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 80 (I80T)
Ref Sequence ENSEMBL: ENSMUSP00000041442 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044094]
AlphaFold Q61694
Predicted Effect probably damaging
Transcript: ENSMUST00000044094
AA Change: I80T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000041442
Gene: ENSMUSG00000038092
AA Change: I80T

DomainStartEndE-ValueType
Pfam:RmlD_sub_bind 4 261 1.8e-8 PFAM
Pfam:KR 5 133 3.2e-8 PFAM
Pfam:Polysacc_synt_2 6 134 5.9e-12 PFAM
Pfam:NmrA 6 147 2.7e-12 PFAM
Pfam:Epimerase 6 249 1.2e-23 PFAM
Pfam:GDP_Man_Dehyd 7 187 5.6e-12 PFAM
Pfam:3Beta_HSD 7 288 2e-105 PFAM
Pfam:NAD_binding_4 8 220 3.1e-18 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (61/61)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik G A 11: 78,272,384 probably null Het
2900026A02Rik T C 5: 113,183,072 D1092G probably benign Het
9030624J02Rik A T 7: 118,809,971 I612F probably damaging Het
Abcb11 C T 2: 69,299,867 D282N probably damaging Het
Ahnak A T 19: 9,008,165 N2271I possibly damaging Het
Amz1 A G 5: 140,741,551 S90G probably benign Het
Arhgap5 A G 12: 52,517,698 E484G possibly damaging Het
Arid3c A G 4: 41,729,883 probably null Het
Atp1a1 T C 3: 101,589,872 I373V probably benign Het
Barhl1 T C 2: 28,909,887 E242G probably damaging Het
Cactin CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG 10: 81,321,318 probably benign Het
Casz1 T A 4: 148,951,745 V1488E probably damaging Het
Ccdc175 C A 12: 72,136,041 Q401H probably damaging Het
Cfap36 T C 11: 29,225,925 Y191C probably benign Het
Chmp2b G A 16: 65,545,346 Q119* probably null Het
Cps1 T A 1: 67,197,015 I969N possibly damaging Het
Dennd5a A G 7: 109,901,159 F920L probably damaging Het
Dnah12 A T 14: 26,872,320 T3410S probably benign Het
Fbxo42 T G 4: 141,200,144 S578R possibly damaging Het
Fcgr1 C T 3: 96,284,299 G398R not run Het
Foxa3 A T 7: 19,014,869 Y111N probably damaging Het
Gabbr2 T C 4: 46,846,340 K190E probably benign Het
Gbp10 T C 5: 105,220,098 Y403C possibly damaging Het
Gm906 A T 13: 50,247,168 I374N possibly damaging Het
Kri1 T G 9: 21,286,587 Q89P Het
Lrp6 G T 6: 134,450,818 P1604T probably damaging Het
Metap1 T C 3: 138,466,137 probably null Het
Mkrn3 C T 7: 62,419,782 R87H probably benign Het
Ms4a6d G A 19: 11,590,073 Q155* probably null Het
Myh6 T C 14: 54,961,568 probably null Het
Naip6 G T 13: 100,316,019 P178Q probably damaging Het
Ncapg2 A G 12: 116,414,834 E160G probably damaging Het
Nek6 G A 2: 38,560,965 A127T probably damaging Het
Nell1 T C 7: 50,279,549 V264A probably benign Het
Nlrp2 T A 7: 5,327,628 I590F possibly damaging Het
Olfr1308 A T 2: 111,960,611 M154K probably benign Het
Olfr1310 A G 2: 112,008,475 L237P probably damaging Het
Olfr1390 G A 11: 49,341,048 R172Q not run Het
Olfr503 A C 7: 108,544,900 D125A probably damaging Het
Olfr71 C T 4: 43,706,080 A163T probably benign Het
Otop3 T A 11: 115,346,378 L556Q probably damaging Het
Padi1 T C 4: 140,829,234 D190G probably null Het
Pald1 T C 10: 61,323,331 S774G possibly damaging Het
Pde10a C T 17: 8,757,028 T55I probably benign Het
Pla2g4d T C 2: 120,278,978 M197V probably benign Het
Prom1 C A 5: 44,101,653 probably benign Het
Ptdss1 A G 13: 66,963,362 H164R possibly damaging Het
Rrh A T 3: 129,810,613 I313N probably damaging Het
Slc35b4 A G 6: 34,167,656 I88T probably damaging Het
Slc38a11 C T 2: 65,326,570 V353I probably benign Het
Spdef T A 17: 27,720,245 E42D probably benign Het
Tgoln1 G C 6: 72,616,278 T73R probably benign Het
Tmx1 A G 12: 70,458,850 D129G probably benign Het
Trav13n-4 A T 14: 53,363,978 Y68F probably benign Het
Trp53 T C 11: 69,589,189 S238P probably damaging Het
Trp53bp1 T C 2: 121,236,469 D592G probably benign Het
Ttll5 T C 12: 85,857,464 probably null Het
Urb1 CACTTAC CAC 16: 90,772,573 probably benign Het
Vmn2r43 A T 7: 8,255,307 Y302* probably null Het
Vps13d C T 4: 145,121,368 V2478I Het
Wsb1 A G 11: 79,240,358 V404A probably damaging Het
Zfc3h1 A G 10: 115,403,300 D539G probably damaging Het
Zfp318 T C 17: 46,411,247 V1392A probably damaging Het
Other mutations in Hsd3b5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00730:Hsd3b5 APN 3 98630057 missense probably benign 0.05
IGL00827:Hsd3b5 APN 3 98630098 missense probably benign 0.00
IGL01530:Hsd3b5 APN 3 98619123 missense probably damaging 1.00
IGL01930:Hsd3b5 APN 3 98622159 missense probably benign 0.01
IGL02363:Hsd3b5 APN 3 98630105 missense probably benign 0.08
IGL02396:Hsd3b5 APN 3 98622027 missense probably benign 0.05
IGL02448:Hsd3b5 APN 3 98622131 missense probably damaging 1.00
R0045:Hsd3b5 UTSW 3 98619144 missense probably benign
R0624:Hsd3b5 UTSW 3 98619404 missense probably damaging 0.98
R0745:Hsd3b5 UTSW 3 98619539 missense probably benign 0.12
R0848:Hsd3b5 UTSW 3 98619355 missense probably damaging 1.00
R1112:Hsd3b5 UTSW 3 98630077 missense probably benign 0.00
R1454:Hsd3b5 UTSW 3 98619530 missense probably benign 0.01
R1631:Hsd3b5 UTSW 3 98622077 missense probably damaging 1.00
R1657:Hsd3b5 UTSW 3 98619720 missense possibly damaging 0.89
R1839:Hsd3b5 UTSW 3 98619728 missense probably benign 0.30
R2930:Hsd3b5 UTSW 3 98619212 missense probably benign 0.03
R2982:Hsd3b5 UTSW 3 98619800 missense possibly damaging 0.88
R3158:Hsd3b5 UTSW 3 98622059 missense probably benign 0.00
R4573:Hsd3b5 UTSW 3 98619648 missense probably benign 0.04
R4941:Hsd3b5 UTSW 3 98619063 missense probably damaging 1.00
R5104:Hsd3b5 UTSW 3 98619276 missense probably damaging 1.00
R5416:Hsd3b5 UTSW 3 98619150 missense probably damaging 1.00
R6311:Hsd3b5 UTSW 3 98630090 missense possibly damaging 0.79
R6861:Hsd3b5 UTSW 3 98622012 missense probably damaging 1.00
R7307:Hsd3b5 UTSW 3 98619769 missense probably damaging 0.97
R7615:Hsd3b5 UTSW 3 98630104 missense probably damaging 0.99
R7673:Hsd3b5 UTSW 3 98619441 missense probably damaging 1.00
R7883:Hsd3b5 UTSW 3 98622140 missense probably benign 0.00
R8398:Hsd3b5 UTSW 3 98619404 missense possibly damaging 0.85
R9218:Hsd3b5 UTSW 3 98619038 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TTCCTCCAGGTGTTCCAAAC -3'
(R):5'- TGCTTCCTTCTGTAGAAAGGC -3'

Sequencing Primer
(F):5'- CTCCAGGTGTTCCAAACTAGGTG -3'
(R):5'- TCACCATGACTGCCCTTGAAG -3'
Posted On 2019-09-13