Incidental Mutation 'R7339:Hsd3b5'
ID 569686
Institutional Source Beutler Lab
Gene Symbol Hsd3b5
Ensembl Gene ENSMUSG00000038092
Gene Name hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 5
Synonyms 3(beta)HSDV
MMRRC Submission 045429-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.062) question?
Stock # R7339 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 98525950-98537568 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 98529390 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 80 (I80T)
Ref Sequence ENSEMBL: ENSMUSP00000041442 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044094]
AlphaFold Q61694
Predicted Effect probably damaging
Transcript: ENSMUST00000044094
AA Change: I80T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000041442
Gene: ENSMUSG00000038092
AA Change: I80T

DomainStartEndE-ValueType
Pfam:RmlD_sub_bind 4 261 1.8e-8 PFAM
Pfam:KR 5 133 3.2e-8 PFAM
Pfam:Polysacc_synt_2 6 134 5.9e-12 PFAM
Pfam:NmrA 6 147 2.7e-12 PFAM
Pfam:Epimerase 6 249 1.2e-23 PFAM
Pfam:GDP_Man_Dehyd 7 187 5.6e-12 PFAM
Pfam:3Beta_HSD 7 288 2e-105 PFAM
Pfam:NAD_binding_4 8 220 3.1e-18 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (61/61)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik T C 5: 113,330,938 (GRCm39) D1092G probably benign Het
Abcb11 C T 2: 69,130,211 (GRCm39) D282N probably damaging Het
Ahnak A T 19: 8,985,529 (GRCm39) N2271I possibly damaging Het
Amz1 A G 5: 140,727,306 (GRCm39) S90G probably benign Het
Arhgap5 A G 12: 52,564,481 (GRCm39) E484G possibly damaging Het
Arid3c A G 4: 41,729,883 (GRCm39) probably null Het
Atp1a1 T C 3: 101,497,188 (GRCm39) I373V probably benign Het
Barhl1 T C 2: 28,799,899 (GRCm39) E242G probably damaging Het
Bltp2 G A 11: 78,163,210 (GRCm39) probably null Het
Cactin CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG 10: 81,157,152 (GRCm39) probably benign Het
Casz1 T A 4: 149,036,202 (GRCm39) V1488E probably damaging Het
Ccdc175 C A 12: 72,182,815 (GRCm39) Q401H probably damaging Het
Cfap36 T C 11: 29,175,925 (GRCm39) Y191C probably benign Het
Chmp2b G A 16: 65,342,232 (GRCm39) Q119* probably null Het
Cps1 T A 1: 67,236,174 (GRCm39) I969N possibly damaging Het
Dennd5a A G 7: 109,500,366 (GRCm39) F920L probably damaging Het
Dnah12 A T 14: 26,594,277 (GRCm39) T3410S probably benign Het
Fbxo42 T G 4: 140,927,455 (GRCm39) S578R possibly damaging Het
Fcgr1 C T 3: 96,191,615 (GRCm39) G398R not run Het
Foxa3 A T 7: 18,748,794 (GRCm39) Y111N probably damaging Het
Gabbr2 T C 4: 46,846,340 (GRCm39) K190E probably benign Het
Gbp10 T C 5: 105,367,964 (GRCm39) Y403C possibly damaging Het
Kri1 T G 9: 21,197,883 (GRCm39) Q89P Het
Lrp6 G T 6: 134,427,781 (GRCm39) P1604T probably damaging Het
Metap1 T C 3: 138,171,898 (GRCm39) probably null Het
Mkrn3 C T 7: 62,069,530 (GRCm39) R87H probably benign Het
Ms4a6d G A 19: 11,567,437 (GRCm39) Q155* probably null Het
Myh6 T C 14: 55,199,025 (GRCm39) probably null Het
Naip6 G T 13: 100,452,527 (GRCm39) P178Q probably damaging Het
Ncapg2 A G 12: 116,378,454 (GRCm39) E160G probably damaging Het
Nek6 G A 2: 38,450,977 (GRCm39) A127T probably damaging Het
Nell1 T C 7: 49,929,297 (GRCm39) V264A probably benign Het
Nlrp2 T A 7: 5,330,627 (GRCm39) I590F possibly damaging Het
Or13j1 C T 4: 43,706,080 (GRCm39) A163T probably benign Het
Or2y17 G A 11: 49,231,875 (GRCm39) R172Q not run Het
Or4f57 A T 2: 111,790,956 (GRCm39) M154K probably benign Het
Or4f6 A G 2: 111,838,820 (GRCm39) L237P probably damaging Het
Or52n4b A C 7: 108,144,107 (GRCm39) D125A probably damaging Het
Otop3 T A 11: 115,237,204 (GRCm39) L556Q probably damaging Het
Padi1 T C 4: 140,556,545 (GRCm39) D190G probably null Het
Pald1 T C 10: 61,159,110 (GRCm39) S774G possibly damaging Het
Pde10a C T 17: 8,975,860 (GRCm39) T55I probably benign Het
Pla2g4d T C 2: 120,109,459 (GRCm39) M197V probably benign Het
Prom1 C A 5: 44,258,995 (GRCm39) probably benign Het
Ptdss1 A G 13: 67,111,426 (GRCm39) H164R possibly damaging Het
Rrh A T 3: 129,604,262 (GRCm39) I313N probably damaging Het
Slc35b4 A G 6: 34,144,591 (GRCm39) I88T probably damaging Het
Slc38a11 C T 2: 65,156,914 (GRCm39) V353I probably benign Het
Spata31e3 A T 13: 50,401,204 (GRCm39) I374N possibly damaging Het
Spdef T A 17: 27,939,219 (GRCm39) E42D probably benign Het
Tgoln1 G C 6: 72,593,261 (GRCm39) T73R probably benign Het
Tmx1 A G 12: 70,505,624 (GRCm39) D129G probably benign Het
Trav13n-4 A T 14: 53,601,435 (GRCm39) Y68F probably benign Het
Trp53 T C 11: 69,480,015 (GRCm39) S238P probably damaging Het
Trp53bp1 T C 2: 121,066,950 (GRCm39) D592G probably benign Het
Ttll5 T C 12: 85,904,238 (GRCm39) probably null Het
Urb1 CACTTAC CAC 16: 90,569,461 (GRCm39) probably benign Het
Vmn2r43 A T 7: 8,258,306 (GRCm39) Y302* probably null Het
Vps13d C T 4: 144,847,938 (GRCm39) V2478I Het
Vps35l A T 7: 118,409,194 (GRCm39) I612F probably damaging Het
Wsb1 A G 11: 79,131,184 (GRCm39) V404A probably damaging Het
Zfc3h1 A G 10: 115,239,205 (GRCm39) D539G probably damaging Het
Zfp318 T C 17: 46,722,173 (GRCm39) V1392A probably damaging Het
Other mutations in Hsd3b5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00730:Hsd3b5 APN 3 98,537,373 (GRCm39) missense probably benign 0.05
IGL00827:Hsd3b5 APN 3 98,537,414 (GRCm39) missense probably benign 0.00
IGL01530:Hsd3b5 APN 3 98,526,439 (GRCm39) missense probably damaging 1.00
IGL01930:Hsd3b5 APN 3 98,529,475 (GRCm39) missense probably benign 0.01
IGL02363:Hsd3b5 APN 3 98,537,421 (GRCm39) missense probably benign 0.08
IGL02396:Hsd3b5 APN 3 98,529,343 (GRCm39) missense probably benign 0.05
IGL02448:Hsd3b5 APN 3 98,529,447 (GRCm39) missense probably damaging 1.00
R0045:Hsd3b5 UTSW 3 98,526,460 (GRCm39) missense probably benign
R0624:Hsd3b5 UTSW 3 98,526,720 (GRCm39) missense probably damaging 0.98
R0745:Hsd3b5 UTSW 3 98,526,855 (GRCm39) missense probably benign 0.12
R0848:Hsd3b5 UTSW 3 98,526,671 (GRCm39) missense probably damaging 1.00
R1112:Hsd3b5 UTSW 3 98,537,393 (GRCm39) missense probably benign 0.00
R1454:Hsd3b5 UTSW 3 98,526,846 (GRCm39) missense probably benign 0.01
R1631:Hsd3b5 UTSW 3 98,529,393 (GRCm39) missense probably damaging 1.00
R1657:Hsd3b5 UTSW 3 98,527,036 (GRCm39) missense possibly damaging 0.89
R1839:Hsd3b5 UTSW 3 98,527,044 (GRCm39) missense probably benign 0.30
R2930:Hsd3b5 UTSW 3 98,526,528 (GRCm39) missense probably benign 0.03
R2982:Hsd3b5 UTSW 3 98,527,116 (GRCm39) missense possibly damaging 0.88
R3158:Hsd3b5 UTSW 3 98,529,375 (GRCm39) missense probably benign 0.00
R4573:Hsd3b5 UTSW 3 98,526,964 (GRCm39) missense probably benign 0.04
R4941:Hsd3b5 UTSW 3 98,526,379 (GRCm39) missense probably damaging 1.00
R5104:Hsd3b5 UTSW 3 98,526,592 (GRCm39) missense probably damaging 1.00
R5416:Hsd3b5 UTSW 3 98,526,466 (GRCm39) missense probably damaging 1.00
R6311:Hsd3b5 UTSW 3 98,537,406 (GRCm39) missense possibly damaging 0.79
R6861:Hsd3b5 UTSW 3 98,529,328 (GRCm39) missense probably damaging 1.00
R7307:Hsd3b5 UTSW 3 98,527,085 (GRCm39) missense probably damaging 0.97
R7615:Hsd3b5 UTSW 3 98,537,420 (GRCm39) missense probably damaging 0.99
R7673:Hsd3b5 UTSW 3 98,526,757 (GRCm39) missense probably damaging 1.00
R7883:Hsd3b5 UTSW 3 98,529,456 (GRCm39) missense probably benign 0.00
R8398:Hsd3b5 UTSW 3 98,526,720 (GRCm39) missense possibly damaging 0.85
R9218:Hsd3b5 UTSW 3 98,526,354 (GRCm39) missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TTCCTCCAGGTGTTCCAAAC -3'
(R):5'- TGCTTCCTTCTGTAGAAAGGC -3'

Sequencing Primer
(F):5'- CTCCAGGTGTTCCAAACTAGGTG -3'
(R):5'- TCACCATGACTGCCCTTGAAG -3'
Posted On 2019-09-13